Chronic pain is one of the most prevalent conditions in the United States, affecting an estimated 100 million Americans each year. To put that into perspective, that�s more than the number of people suffering from cancer, heart disease, and diabetes, combined.
Many of these chronic pain sufferers are looking for relief beyond pharmaceuticals which can have unpleasant and even harmful side effects. This has brought them to natural pain management methods like chiropractic care as well as natural substances like curcumin. For many people, these treatment options have brought them relief from the pain and help them return to a more normal lifestyle.
How does it work though? And, more importantly, can it work for you?
What is Curcumin?
Natural herbal turmeric capsules with fresh herb leaves and dry curcumin in paper
Curcumin is a spice that is a relative of ginger and is a component of turmeric. Often in the U.S., the terms curcumin and turmeric are used interchangeably. However, curcumin is what gives turmeric its bright yellow color.
While it is often found in curries and other traditional Indian food, it has also long been used to treat a variety of health issues including inflammation that causes pain in the body. These claims have been backed up by several studies that show the tasty spice has tremendous health benefits to offer.
These studies have shown that curcumin has strong anti-inflammatory properties although why it works is not yet completely understood. This information has prompted further studies to determine the efficacy of curcumin in treating a wide range of conditions including chronic pain.
One study examined the spice�s effects on people suffering from arthritis or joint pain. The results determined that turmeric extract (curcumin) supplements were just as effective as ibuprofen in relieving the pain in patients with knee osteoarthritis. It helped to reduce the inflammation that was causing the pain, bringing the patients much-needed relief.
Taking Curcumin for Better Health
You can get curcumin or turmeric supplements, but there is no standard dosage information available. Your chiropractor can advise you on how much to take and which supplement brands are the best.
You can also use the spice in the foods you eat and gain a good bit of the health properties that way. However, it may be more efficient and more comfortable to take curcumin or turmeric supplements, especially when you are treating inflammation and pain.
Curcumin is generally safe with very few side effects. As with any medication or supplement, some people are sensitive to the spice and may experience diarrhea and nausea.
However, that usually occurs at higher doses or after the patient has been using it for a long time. High doses could also pose a risk if the person has ulcers. It can also irritate the skin is applied topically.
If you are considering incorporating curcumin into your daily diet as a health supplement, you should first talk to your doctor or chiropractor to make sure it is safe for you. Women who are pregnant or nursing should not take the supplements.
People with conditions like diabetes, gallbladder issues, bleeding disorders, kidney disease, or immunity problems should take special care when using the supplement. Also, it can interact with medications like NSAIDs, aspirin, diabetes drugs, statins, blood thinners, and blood pressure medications so talk to your health professional, such as your chiropractor, before taking. They may adjust your dosage or recommend certain nutritional therapies to better support the supplement.
Your chiropractor can help you live a more natural, pain-free life and supplements like curcumin may be a part of that plan. They can help put you on the path to a life well lived.
Many healthcare professionals highly recommend that patients with multiple sclerosis, or MS, avoid dairy. Several research studies have demonstrated a high correlation between MS and dairy, especially cow�s milk. By way of instance, some of the proteins in cow�s milk are targeted by the immune cells of patients with multiple sclerosis. These include butyrophilin and bovine serum albumin, or BSA. Moreover, injecting those same cow�s milk proteins into test animals caused lesions to appear in their central nervous systems.
Some proteins in cow�s milk imitate part of the myelin oligodendrocyte glycoprotein, or MOG, the section of myelin believed to initiate the autoimmune reaction associated with multiple sclerosis. Furthermore, this can trick the immune system into initiating an attack on the MOG, subsequently causing demyelination. Another research study involving more than 135,000 men and women in the United States determined a connection between cow�s milk and the degenerative neurological disorder, Parkinson�s Disease. Researchers have speculated that dairy products, especially cow’s milk, may have a generally toxic effect on nervous tissue.
Lactose intolerance is common throughout the general population, and it is most notably frequent in Mediterranean, Asian, and African populations. People with lactose intolerance experience a variety of symptoms, including bloating, cramps, diarrhea, and nausea. Given the high potential risks for people with MS consuming dairy products, despite a lack of conclusive evidence, healthcare professionals recommend avoiding the consumption of dairy products, among other types of foods. The purpose of the article below is to discuss the nutrition facts in multiple sclerosis, including which types of foods patients with MS should avoid, such as dairy.
Abstract
The question whether dietary habits and lifestyle have influence on the course of multiple sclerosis (MS) is still a matter of debate, and at present, MS therapy is not associated with any information on diet and lifestyle. Here we show that dietary factors and lifestyle may exacerbate or ameliorate MS symptoms by modulating the inflammatory status of the disease both in relapsing-remitting MS and in primary-progressive MS. This is achieved by controlling both the metabolic and inflammatory pathways in the human cell and the composition of commensal gut microbiota. What increases inflammation are hypercaloric Western-style diets, characterized by high salt, animal fat, red meat, sugar-sweetened drinks, fried food, low fiber, and lack of physical exercise. The persistence of this type of diet upregulates the metabolism of human cells toward biosynthetic pathways including those of proinflammatory molecules and also leads to a dysbiotic gut microbiota, alteration of intestinal immunity, and low-grade systemic inflammation. Conversely, exercise and low-calorie diets based on the assumption of vegetables, fruit, legumes, fish, prebiotics, and probiotics act on nuclear receptors and enzymes that upregulate oxidative metabolism, downregulate the synthesis of proinflammatory molecules, and restore or maintain a healthy symbiotic gut microbiota. Now that we know the molecular mechanisms by which dietary factors and exercise affect the inflammatory status in MS, we can expect that a nutritional intervention with anti-inflammatory food and dietary supplements can alleviate possible side effects of immune-modulatory drugs and the symptoms of chronic fatigue syndrome and thus favor patient wellness.
Keywords:complementary alternative medicine, gut microbiota, inflammation, lifestyle, multiple sclerosis, nutrition
Introduction
Multiple sclerosis (MS) is a chronic, inflammatory, and autoimmune disease of the central nervous system (CNS), leading to widespread focal degradation of the myelin sheath, variable axonal and neuronal injury, and disabilities in young adults, mostly women. The disease is characterized by disseminated and heterogeneous perivascular inflammatory processes at the blood�brain barrier (BBB), with involvement of autoreactive T cells, B lymphocytes, macrophages, and microglial cells against brain and spinal cord white matter (McFarland and Martin, 2007; Constantinescu and Gran, 2010; Kutzelnigg and Lassmann, 2014).
Antibodies (Krumbholz et al., 2012), activated complement (Ingram et al., 2014), cytokines, mitochondrial dysfunction (Su et al., 2009), reactive oxygen species (ROS; Gilgun-Sherki et al., 2004), and matrix metalloproteinases (MMPs; Liuzzi et al., 2002; Rossano et al., 2014) may cooperate to yield the pathology.
From the clinical point of view, there are at least two main forms of the disease: the relapsing-remitting MS (RRMS; about 85% of clinical cases) and the primary-progressive MS (PPMS; about 15% of the clinical cases) (Dutta and Trapp, 2014; Lublin et al., 2014). In RRMS, which usually evolves in secondary-progressive MS (SPMS), relapses are associated with increased systemic inflammation and formation of lesions in the brain, followed by more or less complete remissions, whereas the pathogenesis of PPMS is characterized by progressive neurological damages rather than relapses and remissions.
At present, there are at least 10 disease-modifying therapies that have been found to slow disease progression and prevent some disability symptoms, but only in the case of RRMS. However, as the disease is complex in nature and unique in the individual course, no patient responds to therapy in the same way (Loleit et al., 2014). Similarly, there are no truly reliable biomarkers that allow for everyone to evaluate the effectiveness of treatment and it is therefore important to discover novel markers of the disease (Fernandez et al., 2014).
The lack of response to immune-modulatory therapies in the case of PPMS, otherwise effective in the treatment of RRMS, may be due to different pathogenic mechanisms acting in RRMS and PPMS. However, this is not true with regard to inflammation: A significant association between inflammation and neurodegeneration has been observed in the brain not only in acute and relapsing MS but also in the secondary and primary progressive MS (Frischer et al., 2009; Lassmann, 2013), and active MS lesions are always associated with inflammation (Kutzelnigg and Lassmann, 2014). Thus, inflammation must be the target for the treatment of both forms of the disease.
Linking Inflammation with Dietary Habits and Lifestyle
What causes the inflammatory processes in MS? MS is a complex disease, and the genetic and the immunological components are not sufficient to explain its origin. Actually, MS has a multifactorial nature and various environmental factors or metabolic conditions may have a role in its development (Ascherio, 2013): viral infections (Ascherio et al., 2012; Venkatesan and Johnson, 2014), heavy metal poisoning (Latronico et al., 2013; Zanella and Roberti di Sarsina, 2013), smoking (Jafari and Hintzen, 2011), childhood obesity (Munger, 2013), low vitamin D status (Ascherio et al., 2014), or incorrect lifestyle, including wrong dietary habits (Riccio, 2011; Riccio et al., 2011; Riccio and Rossano, 2013).
None of the above-mentioned environmental factors alone can explain the disease; however, the following considerations make more attractive the involvement in MS of dietary habits and lifestyle, rather than infections or smoking, as factors that may influence the course of the disease:
Geographical distribution: MS is more prevalent in Western countries with the highest income and most distant of the equator. Features of these countries are a sedentary lifestyle, a high-calorie diet rich in saturated fats of animal origin (Western diet), and low sunshine exposure (WHO and MSIF, 2008).
Effect of migration: With the migration from an area of high incidence of MS to another place with low incidence before age of 15 years, the low risk is acquired, while the migration after this age does not change the level of risk. This aspect may be linked with nutritional, rather than with infectious or toxicological environmental factors (McLeod et al., 2011).
Low availability of vitamin D: Another environmental factor related to diet and geographical distribution is the availability of vitamin D, which is lower at latitudes with lower exposure to sunlight. Patients with MS have a low content of vitamin D (Ascherio et al., 2014), but this is true also for other chronic inflammatory diseases (Yin and Agrawal, 2014).
Postprandial inflammation: High animal fat/high sugar and refined carbohydrate diet is associated with postprandial inflammation (Erridge et al., 2007; Ghanim et al., 2009; Margioris, 2009).
High body mass index: High body mass index (BMI) before age 20 is associated with 2� increased risk (Hedstr�m et al., 2012). Note that BMI is correlated with gut microbiota status.
Similarity with other inflammatory diseases related to wrong dietary habits: MS has some similarities with inflammatory bowel disease (IBD; Cantorna, 2012): both have low vitamin D and are influenced from environmental factors (Dam et al., 2013). Furthermore, glatiramer acetate (GA, or Copolymer 1/Copaxone) is beneficial in both diseases (Aharoni, 2013) and there is an increased incidence of IBD among MS patients.
How Food Affects the Course of Inflammatory Diseases: A Basic Approach
The observations reported above suggest that the nutritional status may influence the course of MS. However, the question arises of how dietary molecules could exacerbate or ameliorate MS symptoms, and in general how they could favor or downregulate inflammation at molecular level. In particular, it is important to clarify what are the targets of dietary molecules and the molecular mechanisms involved, if any.
Fundamentally, we can say that the food we consume has a broad impact on our development, behavior, health condition, and lifespan by acting on two main targets: (A) the cells of our body and (B) the commensal gut microbiota (Figure 1).
On one hand, different kind and amount of dietary factors can interact with enzymes, transcription factors, and nuclear receptors of human cells. This may induce specific modifications of cellular metabolism toward either catabolism or anabolism and modulate the inflammatory and autoimmune responses in our body (Desvergne et al., 2006).
On the other hand, we have to consider the impact of diet and lifestyle on our intestinal microflora. We are indeed metaorganisms living with trillions (1014) of microbial cells (roughly 10 times the cells of our body) and thousands of different microorganisms known as the gut microbiota. This complex ecosystem is an essential part of our organism and influences both our immune system and our metabolism. Therefore, it has a strong impact on our health.
In health, there is a close mutualistic and symbiotic relationship between gut microbiota and humans, and gut microbiota provides a number of useful metabolic functions, protects against enteropathogens, and contributes to normal immune functions. This is the normal state of the human intestinal microbiota, called eubiosis. Distortion from eubiosis, linked with a decrease of intestinal biodiversity and increase of pathogenic bacteria, is called dysbiosis. The most common consequence of a dysbiotic gut microbiota is the alteration of the mucosal immune system and the rise of inflammatory, immune, metabolic, or degenerative diseases (Chassaing and Gewirtz, 2014).
Different kinds and amounts of dietary factors elicit the selection of specific gut microbial populations changing type and number of microbial species toward eubiosis or dysbiosis, simply acting through the preferential feeding of one or the other microbial population. If our diet favors the change to a dysbiotic gut microbiota, this may lead to gut inflammation, alteration of intestinal immunity, and then to systemic inflammation and chronic inflammatory diseases.
How Dietary Factors Influence the Metabolism of Human Cells and Modulate Inflammation
To understand how dietary molecules can directly influence the metabolism of human cells, it is necessary to describe first what are the enzymes and transcription factors involved in catabolism or anabolism in the cell.
As shown on the left in Figure 2, oxidative metabolism is upregulated by two enzymes and a nuclear receptor. The enzymes are the AMP-activated protein kinase (AMPK; Steinberg and Kemp, 2009) and the Sirtuins (SIRT), a group of histone deacylating enzymes, which are activated by NAD+ (Zhang et al., 2011; Rice et al., 2012). The nuclear receptor is represented by the isotypes of the peroxisome proliferator-activated receptors (PPARs; Desvergne and Wahli, 1999; Burns and VandenHeuvel, 2007).
�
PPAR isotypes upregulate the transcription of genes involved in the beta-oxidation of fatty acids in mitochondria and peroxisomes and form a network with AMPK and Sirtuins pathways. The AMPK-Sirtuins-PPAR pathway is activated by a lifestyle based on calorie restriction and physical exercise, as well as by some bioactive molecules (polyphenols, found in vegetables and fruits, and omega-3 (n-3) long-chain polyunsaturated fatty acids [PUFA], found in fish). Ligand-activated PPAR isotypes form heterodimeric complexes with the retinoid X-receptor (RXR), which, in turn, is activated by 9-cis-retinoic acid (RA).
Conversely, as shown on the right in Figure 2�like on the other dish of an imaginary balance�high intake of energy-dense nutrients leads to the upregulation of anabolism, including lipogenesis and cell growth, through the activation of the sterol regulatory element-binding proteins, SREBP-1c and SREBP-2 (Xu et al., 2013), and the carbohydrate responsive element-binding protein, ChREBP (Xu et al., 2013). SREBP-1c and SREBP-2 are under the control of the nuclear receptors called the liver X receptors (LXR; Mitro et al., 2007; Nelissen et al., 2012). LXR isotypes, which are activated by the cholesterol derivatives oxysterols and glucose, have a relevant role in the synthesis of lipids by activating SREBP-1c and the synthesis of triacylglycerols, while inhibiting SREBP-2 and the synthesis of cholesterol.
Central to the understanding of the link between diet and inflammation are two transcription factors involved in inflammation and autoimmunity: the nuclear transcription factor-kB (NF-kB) and the activator protein (AP-1; Yan and Greer, 2008). In MS, both NF-kB and AP-1 are activated and induce the expression of several proinflammatory genes and the production of proinflammatory molecules. The cause of their activation in MS is not known but, as shown in Figure 2 for NF-kB, this can be activated not only by viruses, cytokines, and oxidative stress but also by some dietary components such as saturated fatty acids or trans unsaturated fatty acids, which therefore can be considered proinflammatory.
Downregulation of the proinflammatory NF-kB can be achieved by the inhibitory binding of the RA-activated forms of the retinoid X-receptor isotypes (RXRs; P�rez et al., 2012; Zhao et al., 2012; Fragoso et al., 2014).
As shown in the center of Figure 2 and more in detail in Figure 3, the active forms of RA-RXRs are heterodimers resulting from their association with specific ligand-activated nuclear receptors, namely PPARs, LXRs, and vitamin D receptor (VDR).
All three nuclear receptors�PPAR, LXR, and VDR�must be activated by specific ligands. As indicated in Figure 2, the ligands can be specific dietary factors and this clarify how cells respond to changes in nutritional status and regulate energy homeostasis but represents also the molecular key to understanding how nutrients can influence the course of chronic inflammatory diseases (Heneka et al., 2007; Zhang-Gandhi and Drew, 2007; Krishnan and Feldman, 2010; Cui et al., 2011; Schnegg and Robbins, 2011; Gray et al., 2012).
Therefore, each of the three nuclear receptors�PPAR, LXR, and VDR�competes for the binding to RA-RXR and forms hetero-complexes that can inhibit NF-kB and exert a tight control over the expression of inflammatory genes, thus integrating metabolic and inflammatory signaling. It is clear that there is competition between the three receptors PPAR, LXR, and VDR-D, for the binding with RA-RXR, but this competition should have an influence only on metabolism and not on inflammation, because it is not yet known which of the three heterodimers is more effective in inhibiting NF-kB.
Obviously, the production of proinflammatory molecules in the course of relapses is a biosynthetic process: It is sustained by hypercaloric diets and counteracted by low-calorie diets. In principle, what favors anabolism will promote the inflammatory processes, while what favors catabolism will contrast them (Figure 4).
How Dietary Factors Influence Composition and Biodiversity of Gut Microbiota and Alter Host�Microbiota Relationship
The Link Between Lifestyle, Dietary Habits, and Gut Microbiota Composition
The composition of the intestinal microflora is highly individual and is influenced by many factors such as diet, physical activity, stress, medications, age, and so forth. Each of us has a unique set of at least 100 to 150 species of bacteria.
An easy way to discuss about the effect of food and lifestyle on gut microflora is to restrict the overview to only two dominant bacterial divisions�the Bacteroidetes and the Firmicutes�accounting for about 90% of the total, as it has been shown that the ratio Bacteroidetes/Firmicutes (B/F) is influenced by long-term dietary habits (Cani and Delzenne, 2009; Wu et al., 2011; Lozupone et al., 2012; Tremaroli and B�ckhed, 2012; Panda et al., 2014).
A comparative study of De Filippo et al. (2010) in children from Florence and from Burkina Faso in Africa showed that long-term dietary habits have significant effects on human gut microbiota.
In this study, the Burkina Faso diet was based on the consumption of plant polysaccharides such as millet and sorghum (10 g fibers/day and 662�992 kcal/day), whereas the diet of Italian children was Western style, based on proteins, animal fat, sugar-sweetened drinks, and refined carbohydrates (5.6 g fibers/day and 1,068�1,512 kcal/day). Analysis of fecal samples in the children from Africa showed the prevalence of the Bacteroidetes (73%)�mainly Prevotella and Xylanibacter�and low levels of Firmicutes (12%). On the contrary, a prevalence of Firmicutes (51%) over the Bacteroidetes (27%) was observed in Italian children, but the Bacteroidetes shifted from Prevotella and Xylanibacter to Bacteroides. These latter are usually selected among the Bacteroidetes because they can use also simple sugars in addition to complex glycans, and simple sugars are normal components of Western diets.
In conclusion, the B/F ratio increases in association with a diet rich in complex carbohydrates (nondigestible by our enzymes) because the symbiotic and usually nonharmful Bacteroidetes, such as Prevotella and Xylani bacter, love to have complex glycans to eat. Bacteria consuming complex glycans produce butyrate, which down regulate the activation of proinflammatory NF-kB (Figure 3).
Conversely, Western, energy-dense diets change the gut microbiota profile and increase the population of Firmicutes (including the Mollicutes), more suited to extract and harvest energy, but often pathogenic (Moschen et al., 2012).
The Link Between Dysbiotic Gut Microbiota and Chronic Inflammation
In a dysbiotic gut microbiota, the B/F ratio is low and the possibly pathogenic Firmicutes prevail over Bacteroidetes (Figure 5). The failure of microbial balance and the decrease of biodiversity occurring in dysbiosis lead to the disruption of the complex interplay between the microbiota and its host and contribute to low-grade endotossemia, and chronic intestinal and systemic inflammation. With the onset of systemic inflammation, the risk of chronic inflammatory and immune-mediated diseases increases (Tilg et al., 2009; Brown et al., 2012; Maynard et al., 2012).
Actually, in the presence of a dysbiotic microbiota, gut endotoxin/lipopolysaccharide (LPS) is increased, regulatory T cells (Treg) are defective, and the aryl hydrocarbon receptors and proinflammatory Th17 cells are activated (Cani et al., 2008; Veldhoen et al., 2008).
LPS leads to the dysfunction of the mucosal barrier and affects other tissues when its plasma level increases above 200 pg/ml serum. The increased gut permeability due to the dysbiotic gut microbiota may be exemplified by the passage of IgA and IgG antibodies against gluten and gliadin, also observed in MS patients (Reichelt and Jensen, 2004).
The Link Between Dysbiotic Gut Microbiota and MS
In our previous work, we have proposed that the model linking microbiota alteration�due to Western diet and lifestyle�and the failure of the correct communication between the microbiota and the intestine, leading to low-grade endotoxemia and systemic autoimmune inflammation, might be valid also for the pathogenesis of MS (Fern�ndez et al., 2012; Riccio, 2011). In fact, MS shares with other chronic inflammatory diseases common mechanisms, all probably based on the persistence of low-grade endotoxemia related to wrong lifestyle and dietary habits together with a latent dysbiosis. Moreover, the existence of a gut microbiota-brain axis, which is now more than an emerging concept, suggests that intervention on gut microbiota may be a fruitful strategy for future treatment of complex CNS disorders (Cryan and Dinan, 2012).
The possible direct link between gut microbiota and MS has been shown experimentally by Berer et al. (2011). Using transgenic mice, Berer et al. have shown that gut commensal bacteria can trigger a relapsing-remitting autoimmune disease driven by myelin-specific CD4+ T cells and demyelination, given the availability of MOG�the autoantigen myelin oligodendrocyte glycoprotein. In another study, it was shown that antibiotic treatment directed to alter gut microflora suppresses experimental allergic encephalomyelitis (EAE; Yokote et al., 2008).
These findings suggest that gut microbiota may play a crucial role in the starting phase of MS and may also predispose host susceptibility to other CNS autoimmune diseases as well as to neuropsychiatric disorders such as autism, depression, anxiety, and stress. A new concept of gut microbiota-brain axis is emerging (Wang and Kasper, 2014).
On these grounds, understanding the role of gut microbiota in health and disease can lay the foundation to treat chronic diseases by modifying the composition of gut microbiota through the choice of a correct lifestyle, including dietary habits. Moreover, direct manipulation of the gut microbiota may improve adaptive immune response and reduce inflammatory secretions. For example, because a specific role of intestinal Th17 cells has been suggested in MS immunopathology (Sie et al., 2014), promoting Treg cell differentiation and reducing pathogenic Th17 cells might prevent recurrence of autoimmunity in MS patients (Issazadeh-Navikas et al., 2012).
On these grounds, the discovery that the defect of the Treg/Th17 balance observed in MS models is also present in MS patients, could have important clinical implications, as this defect can be modulated by changes in the microbiota composition, which in turn is modulated by dietary changes (David et al., 2014).
Proinflammatory Dietary Factors
The components of the diet whose intake must be controlled to avoid the rise of inflammatory processes in MS, as well as in other chronic inflammatory diseases, are as follows:
Saturated fatty acids of animal origin;
Unsaturated fatty acids in the trans configuration (hydrogenated fatty acids);
Red meat;
Sweetened drinks, and in general hypercaloric diets rich in refined (low-fiber) carbohydrates, in addition to animal fat;
Increased dietary salt intake;
Cow�s milk proteins of the milk fat globule membrane (MFGM proteins).
Fat of Animal Origin
Saturated fatty acids of animal origin, which are found in foods such as whole milk, butter, cheese, meat, and sausages, are the components of the diet taken into account more frequently for their deleterious influence on the course of MS.
In 1950, Swank suggested that the consumption of saturated animal fat is directly correlated with frequency of MS, but a link between restricted intake of animal fat and remission of MS was reported only in 2003 (Swank and Goodwin, 2003). According to Swank and Goodwin, high-fat diets lead to the synthesis of storage lipids and cholesterol and cause a decrease of membrane fluidity and possible obstruction of capillaries, and the onset or increase of inflammation.
Other more recent studies indicate that the action of saturated fat is controlled at the transcriptional level and influence both gene expression, cell metabolism, development, and differentiation of cells. More in general, the assumption of animal fat is often linked to a high-calorie intake, which is on its own a detrimental factor for many chronic inflammatory diseases. Finally, as described later in this article, an excess of saturated animal fat leads to a dysbiotic intestinal microbiota, dysfunction of intestinal immunity, and low-grade systemic inflammation and represents a possible cause of some human chronic disorders.
Trans Fatty Acids
Trans fatty acids (TFAs) are unsaturated fatty acids that contain at least one nonconjugated double bond in the trans configuration (Bhardwaj et al., 2011).
As products of partial hydrogenation of vegetable oils, they were introduced in the 1960s to replace animal fat, but only much later it was found that they have the same deleterious effect on the metabolism and, as the saturated fatty acids, increase the levels of cholesterol and promote the formation of abdominal fat and weight gain. TFAs intake was found to be positively associated with gut inflammation and the upregulation of proinflammatory citokines in Th17 cell polarization (Okada et al., 2013). Moreover, TFAs interfere with the metabolism of natural unsaturated fatty acids, which have the cis configuration.
TFAs are found in margarine and other treated (hydrogenated) vegetal fat, in meat and dietary products from ruminants and in snacks. They may be present also in French fries and other fried food, as they are also formed in the frying.
Red Meat
Red meat contains more iron heme than white meat. The iron is easily nitrosylated and this facilitates the formation of endogenous nitroso-compounds (NOCs; Joosen et al., 2010). Red meat intake shows indeed a dose�response relation with NOCs formation, whereas there is no such relation for white meat. NOCs are mutagenic: induce nitrosylation and DNA damage. Processed (nitrite-preserved) red meat increases the risk. Heterocyclic amines are formed during cooking of meat at high temperatures, but this is not specific for red meat (Joosen et al., 2010).
Abnormal iron deposits have been found at the sites of inflammation in MS (Williams et al., 2012) and consumption of red meat is associated with higher levels of ?-GT and hs-CRP (Montonen et al., 2013).
Noteworthy, we do not have N-glycolylneuraminic acid (Neu5Gc), a major sialic acid, because an inactivating mutation in the CMAH gene eliminated its expression in humans. Metabolic incorporation of Neu5Gc from dietary sources�particularly red meat and milk products�can create problems, as humans have circulating anti-Neu5Gc antibodies and this implies the possible association with chronic inflammation (Padler-Karavani et al., 2008).
Finally, meat contains arachidonic acid (the omega-6 (n-6) PUFA, which is the precursor of proinflammatory eicosanoids [prostaglandins, thromboxanes, and leukotrienes]) and activates the Th17 pathway (Stenson, 2014).
High Intake of Sugar and Low Intake of Fiber
The high intake of sugar-sweetened beverages and refined cereals, with low fiber content, increases rapidly the number of calories and glucose level. The subsequent increase of insulin production upregulates the biosynthetic pathways and inter alia the production of arachidonic acid and its proinflammatory derivatives.
Increased Dietary Salt Intake
Increased dietary salt intake might be an environmental risk factor for the development of autoimmune diseases, as it has been found that it can induce pathogenic Th17 cells and related proinflammatory cytokines in EAE (Kleinewietfeld et al., 2013; Wu et al., 2013). Th17 cells have been involved in the development of MS.
Cow�s Milk Fat and the Proteins of the Milk Fat Globule Membrane
Milk fat is dispersed in a homogeneous way and protected from oxidation, thanks to a membrane made of lipids and particular proteins called proteins of the milk fat globule membrane (MFGM; Riccio, 2004). These proteins, which account for only 1% of milk proteins, have an informational rather than a nutritional value. In human lactation, they are needed for the correct formation of the digestive, nervous, and immune systems in infants. This flow of information is obviously not relevant, or not required at all, in adulthood and, as well, in the case of cow�s milk taken for human nutrition. In adult age, MFGM proteins of cow�s milk no longer have an informational role and may be eliminated from the diet together with milk fat.
The removal of MFGM proteins from whole cow�s milk is particularly relevant in the case of MS. The most representative MFGM protein (40% of total MFGM proteins), butyrophilin (BTN), is indeed suspected to have a role in MS, as it is very similar to MOG, one of the candidate autoantigen in MS. BTN and MOG share the same behavior in MS experimental models, and MOG/BTN cross-reactive antibodies have been found in MS, in autism and in coronary heart disease (CHD; Riccio, 2004). On these grounds, the patient with MS should avoid the intake of whole cow�s milk and prefer skimmed milk, which, in addition, has no animal fat.
Another point of view is that of Swanson et al. (2013). They have found that BTN or BTN-like molecules might have a regulatory role in immunity and therefore they suggest that BTN or BTN-like molecules could be useful to induce Treg development.
Hypercaloric Diets and Postprandial Inflammation
After each meal, we may experience a transient and moderate oxidative stress and a moderate inflammatory response depending on type and quantity of food. Dietary habits based on a frequent and persistent exposure to meals with high intake of salt/animal fat and trans fat/sugar-sweetened drinks stresses our immune/metabolic system and the subsequent possible failure of homeostasis may lead to immune and metabolic disorders of diverse nature.
Taken together, the diet-dependent stress might be due to following reasons: (a) calorie intake: the higher the calories, the more the oxidative stress induced; (b) glycemic load of a meal: acute postprandial glycemic peaks may induce a release of insulin much higher than necessary; (c) lipid pattern: saturated animal fat, trans fatty acids, and omega-6 (n-6) long-chain PUFA promote postprandial inflammation. As reported in the following sections, postprandial inflammation is attenuated or suppressed by n-3 PUFA and polyphenols, calorie restriction, and physical exercise.
Anti-Inflammatory Natural Bioactive Compounds: Useful to Tackle MS and Prevent Relapses?
Specific bioactive dietary molecules are able to counteract the effects of pathogenic microbial agents and downregulate the expression of inflammatory molecules. Among them, the most important compounds are the polyphenols and carotenoids from vegetables, n-3 PUFA from fish, vitamins D and A, thiol compounds such as lipoic acid, and oligoelements such as selenium and magnesium.
Most of the above-mentioned compounds, with exception of PUFA, which are not antioxidant, are known for their antioxidant properties. The rationale for the use of antioxidants in MS is based on the observation that oxidative stress is one of the most important components of the inflammatory process leading to degradation of myelin and axonal damage. However, it is now known that dietary antioxidants have additional biological properties going far beyond the simple antioxidant activity. Indeed, they are able to counteract the negative effects of microbial agents and saturated or trans fatty acids, downregulating the expression of proinflammatory molecules, oxidative stress, and angiogenesis.
Polyphenols
All polyphenols�which are present in vegetables, cereals, legumes, spices, herbs, fruits, wine, fruit juices, tea, and coffee�have anti-inflammatory, immune-modulatory, anti-angiogenic, and antiviral properties and stimulate the catabolic pathways (Gupta et al., 2014; Wang et al., 2014). They are found in plants in the form of glycosides, esters, or polymers, too large to enter the intestinal membrane. Aglycons released from gut microbiota are conjugated to glucuronides and sulfates in intestine and liver. Their solubility and bioavailability are very poor (�M; Visioli et al., 2011).
From a structural point of view, polyphenols include flavonoids and nonflavonoids molecules (Bravo, 1998). The most important flavonoids are quercetin (onions, apples, citrus fruit, and wine; Min et al., 2007; Sternberg et al., 2008), catechins (green tea; Friedman, 2007), and daidzein and genistein (soy; Castro et al., 2013; Zhou et al., 2014). The most important nonflavonoids are resveratrol (chocolate, peanuts, berries, black grapes, and red wine; Das and Das, 2007; Cheng et al., 2009; Shakibaei et al., 2009), curcumin (spice turmeric of ginger family, curry; Prasad et al., 2014), and hydroxytyrosol (olive oil; Hu et al., 2014).
It has been found that the anti-inflammatory effect of polyphenols in vitro may depend on their chemical structure (Liuzzi et al., 2011). Thus, a mixture of flavonoids and nonflavonoids may be more effective than supplementation with only one polyphenol.
Two examples of the most studied polyphenols are quercetin and resveratrol. Quercetin is present mainly as a glucoside. Most of its effects are additive to those of interferon-?. Quercetin is not toxic, but its oxidation product, quercetin quinone, is very reactive toward the SH groups of proteins and glutathione and may be toxic (Boots et al., 2008). Addition of lipoic acid or N-acetylcysteine can limit the toxic effects.
Resveratrol is glucuronated in the liver and absorbed in this form mainly in the duodenum but only in very limited amount. Depending on its concentration, resveratrol can induce the death of a wide variety of cells by necrosis or apoptosis. In this regard, it is commonly accepted that resveratrol has neuroprotective effects; however, it has been also reported that it can exacerbate experimental MS-like diseases (Sato et al., 2013). These discrepancies can be attributed to the different concentrations used in vitro or bioavailable in vivo, as resveratrol has opposite effects at concentrations of 10?5 M (proliferation of human mesenchimal cells) and 10?4 M (inhibition of proliferation). In our experience, resveratrol has a neurotrophic effect on cortical neurons in culture only at very low concentration, whereas at higher concentration, it may have toxic effect. But in the case of oxidative stress, resveratrol has neuroprotective properties also at the higher concentrations.
Vitamin D, Vitamin A, Carotenoids, Other Vitamins, and Oligoelements
Other compounds and elements that may be useful as supplements in MS are the vitamins D, A, E, C, B12 (Mastronardi et al., 2004), and niacin (Penberthy and Tsunoda, 2009), and oligoelements such as selenium (Boosalis, 2008) and magnesium (Galland, 2010).
Vitamin D has immune-modulatory roles and represents the most promising dietary molecule for the treatment of chronic inflammatory diseases such as MS (Smolders et al., 2008; Pierrot-Deseilligny, 2009; Cantorna, 2012; Ascherio et al., 2014). As already mentioned, it is generally believed that the special geographical distribution of MS in the world can also be attributed to the reduced availability of vitamin D3, due to insufficient exposure to sunlight in some countries, and the lack of active vitamin D may be another possible cause of environmental origin of MS. However, low levels of active vitamin D may be due also to its altered metabolism or function not only to the exposure to sunlight. In fact, the failure of vitamin D3 (cholecalciferol) supplementation to show beneficial effects on body weight or on the course of inflammatory diseases may be due to the persistence of its deficiency despite its administration.
Vitamin D3 (cholecalciferol), formed after exposure to sunshine, is hydroxylated in the liver to 25-(OH) D3 (calcidiol) by the P450 enzymes CYP27A1 or CYP2R1, and subsequently activated in the kidney by CYP27B1 to 1?, 25-(OH)2 D3 (calcitriol). This latter, the active form of vitamin D, is inactivated by CYP24A1 to 1?, 24,25-(OH)3 D3 (calcitroic acid). This means that the levels of active vitamin D depend on the relative rates of its synthesis via CYP27B1 and its modifications via CYP24A1 (Schuster, 2011). High CYP24A1 expression, induced by endogenous compounds and xenobiotics, might lead to low levels of vitamin D and cause or enhance chronic inflammatory diseases and cancer. On these grounds, it is important to follow up the level of vitamin D in the course of vitamin D administration. If vitamin D levels remain low, the expression of CYP24A1 mRNA should be examined, and determination of CYP27B1 and CYP24A1 activities and their inhibition should be tested (Chiellini et al., 2012, K�sa et al., 2013).
Another important aspect regards the VDR. The active metabolite of vitamin D�1?, 25-dihydroxyvitamin D�binds to VDR, and the complex VDR-D controls the expression of several genes involved in processes of potential relevance to chronic diseases. As represented in Figures 2 and and3,3, the VDR-D complex competes with ligand-activated PPARs or LXRs for the binding to RA-RXR. The heterodimeric complexes bind to the proinflammatory transcription factor NFkB and downregulate the synthesis of proinflammatory molecules. In this context, when evaluating the effectiveness of vitamin D supplementation in the course of MS, one should consider the eventual polymorphisms affecting the VDR, which has been recently associated with obesity, inflammation, and alterations of gut permeability (Al-Daghri et al., 2014).
Moreover, the finding that that VDR-D activate the Sirtuin SIRT-1 (An et al., 2010; Polidoro et al., 2013) suggests that vitamin D has an influence also on cell metabolism and therefore may have properties similar to those of many other natural dietary supplements: upregulate oxidative metabolism and downregulate inflammation.
Finally, it should be considered that there are differences between data in humans and experimental models. Actually, in humans, unlike in mice, obesity is associated with poor vitamin D status (Bouillon et al., 2014).
Among the carotenoids, the most important is lycopene (tomato, water melon, and pink grape fruit; Rao and Rao, 2007). Besides to be a very strong antioxidant, lycopene can give beta-carotene and retinoic acid, and the latter can activate the RXR receptor (Figure 2). Although higher intakes of dietary carotenoids, vitamin C, and vitamin E did not reduce the risk of MS in women (Zhang et al., 2001), the relevance of lycopene and vitamin A against inflammation cannot be disregarded.
Omega-3 (n-3) Essential Fatty Acids and Poly-Unsaturated Fatty Acids from Vegetables, Seafood, and Fish Oil
n-3 essential fatty acids (EFA) and PUFA represent a valid alternative to saturated fatty acids of animal origin.
Vegetable and vegetable oils contain the essential fatty acids linoleic acid (n-6) and linolenic acid (n-3). n-6 and n-3 fatty acids have opposite effects and their presence in the diet should be equivalent (Schmitz and Ecker, 2008). However, in Western diets, the ratio n-6/n-3 is increased from 6 to 15 times and this leads to a higher incidence of cardiovascular and inflammatory diseases. In fact, the linoleic acid leads to the formation of arachidonic acid (20:4), the precursor of the proinflammatory eicosanoids prostaglandins-2, leukotrienes-4, and thromboxanes-2. The synthesis of these eicosanoids is favored by insulin, and inhibited by aspirin, as well as by the n-3 long-chain PUFA EPA (eicosapentaenoic acid) and DHA (docosahexaenoic acid), which derive from n-3 linolenic acid.
Both DHA and EPA are found in seafood and fish oil. Both show remarkable anti-inflammatory, anti-thrombotic, and immune-modulatory activities, comparable with those of statins (Calder, 2006; Farooqui et al., 2007). n-3 PUFA inhibit inflammatory processes and the synthesis of fatty acids and cholesterol, and instead they stimulate the oxidation of fatty acids. On this basis, in chronic inflammatory diseases such as MS, n-3 essential fatty acids (EFA) and n-3 PUFA should prevail in the diet over the n-6 fatty acids. It is interesting to note that DHA is present in high concentrations in the brain and its levels decrease in patients with MS.
In cultured microglial cells activated by LPS, fish oil is as effective as interferon-? in inhibiting the expression of MMP-9 (gelatinase B), an important mediator of neuro-inflammation (Liuzzi et al., 2004, 2007). Moreover, n-3 PUFA significantly decreased MMP-9 levels in few clinical trials, indicating that n-3 PUFA may represent a good complementary treatment in the course of MS (Weinstock-Guttman et al., 2005; Mehta et al., 2009; Shinto et al., 2009). Fish oil has been also found to improve motor performances in healthy rat pups (Coluccia et al., 2009).
n-3 PUFA act in synergy with aspirin on AMPK and COX enzymes but with different mechanisms. Noteworthy, in the presence of aspirin, EPA and DHA form new anti-inflammatory bioactive molecules called resolvins, protectins, and maresins, which are able to reduce cellular inflammation and inflammatory pain (Xu et al., 2010; Hong and Lu, 2013; Serhan and Chiang, 2013). This may be a relevant aspect related to the nutritional intervention in MS. Indeed, the inflammatory processes associated to MS could be also due to the low ratio omega-3 (anti-inflammatory)/omega 6 (inflammatory) PUFA and thereby to the low production of adequate amounts of resolution-inducing molecules lipoxins, resolvins, and protectins that suppress inflammation. Hence, administration of omega-3 PUFA together with aspirin or directly of lipoxins, resolvins, and protectins may form a new approach in the prevention and treatment of MS and other neuroinflammatory diseases. Furthermore, other anti-inflammatory and antiangiogenic eicosanoids can also be produced by the P450 CYP enzymes from EPA and DHA (Yanai et al., 2014). In this context, it should be taken into consideration that statins may interfere negatively with the metabolism of n-3 and n-6, as they can decrease the n-3/n-6 ratio. Thus, treatment with statins should be associated with n-3 PUFA supplementation (Harris et al., 2004).
Seeds oils, from sunflower, corn, soybean, and sesame, contain more n-6 fatty acids than n-3 fatty acids and therefore their assumption should be limited in MS, in order to limit the level of proinflammatory eicosanoid production. On the other hand, coconut oil has a high content of saturated fatty acids. Among vegetable oils, olive oil should be preferred for the good ratio between saturated and unsaturated fatty acids, and because it contains the antioxidant hydroxytyrosol.
Thiolic compounds as Dietary Supplements
Compounds containing thiol groups (�SH) such as ?-lipoic acid (ALA), glutathione, and N-acetylcysteine (NAC) should be taken into consideration as possible dietary supplements to be used for the complementary treatment of MS.
As polyphenols, ALA (Salinthone et al., 2008; green plants and animal foods) has immunomodulatory and anti-inflammatory properties. ALA stabilizes the integrity of the BBB and stimulates the production of cAMP and the activity of protein kinase A. Also NAC might be useful in neurological disorders. It passes through the BBB and protects from inflammation (Bavarsad Shahripour et al., 2014).
The Mediterranean Diet
A recent systematic review and meta-analysis of intervention trials provide evidence that Mediterranean diet patterns reduce inflammation and cardiovascular mortality risk and improves endothelial functions (Schwingshackl and Hoffmann, 2014). These findings are as much encouraging as you think that the true Mediterranean diet is a little different from the one currently described.
It is generally agreed that the Mediterranean diet is based on consumption of extra-virgin olive oil, unrefined cereals, legumes, diverse vegetables (in particular tomatoes) and fruits, dairy products (mostly as pecorino cheese, ricotta, mozzarella, and yogurt), fish and fishery products, and low consumption of animal fat and meat. However, currently, the Mediterranean diet tends to a high consumption of pasta and bread, which means a high intake of gluten.
Once, in true Mediterranean diet, in Southern Italy, meat was eaten two or at most three times a week, only olive oil was used for cooking (extra-virgin quality and the most possible raw), but notably the intake of gluten was about half compared with the current intake. The pasta was eaten with the classic home-made tomato sauce, but in alternative, it was most often mixed with other gluten-free foods. The most common recipes were pasta and potatoes; pasta with either green beans, or artichokes, zucchini, eggplant, turnips, or cabbage; pasta with a mix of vegetables and legumes (minestrone: vegetable soup); and pasta with chickpeas, beans, or lentils. The sugar-sweetened drinks of today were not known. A high assumption of gluten-rich food may lead to nonceliac asymptomatic gluten sensitivity, mucosal intestinal damage, changes in gut microbiota, and low-grade intestinal inflammation. In conclusion, the Mediterranean diet is good, but the intake of gluten must be limited and must be whole grains.
Inflammatory and Anti-Inflammatory Lifestyle
Smoking (Proinflammatory)
Only a few studies have been carried out on the impact of smoking on the course of MS and results are conflicting, perhaps because its effects are difficult to ascertain and enucleate from other factors. Weiland et al. (2014) have found no association between smoking and relapse rate or disease activity, but do not exclude that smokers might have a significantly lower health-related quality of life than non-smokers, whereas Manouchehrinia et al. (2013) found that smoking is associated with more severe disease.
However, as it is shown in Figure 2, it can be expected that cigarette smoke may worsen the course of MS, as it may inhibit the anti-inflammatory activity of Sirtuins (Caito et al., 2010). The oxidative and carbonyl stress induced by cigarette smoke can be reversed by resveratrol (Liu et al., 2014).
Alcohol Consumption (Proinflammatory)
Recent studies shows that alcohol (beer, wine, or liquor) consumption is not associated to MS risk (Massa et al., 2013; Hedstr�m et al., 2014). However, as also shown in Figure 2, alcohol may inhibit the Sirtuin SIRT1 and activate the transcriptional activity of SREBP-1c (You et al., 2008), thus promoting the biosynthesis of lipids and inflammation at the expense of oxidative metabolism.
There are other two aspects of ethanol that should be considered. First, the metabolism of ethanol converts a large number of NAD+ molecules to NADH, limiting the availability of NAD+ required for the activity of Sirtuins. Second, as a substrate of the P450 enzymes, ethanol can interfere with the metabolism of drugs, which are transformed by the same enzymes. The result may be the prolongation and the enhancement of drug action. Altogether, alcohol should be considered as a molecule that interferes with the normal metabolism and facilitates the inflammatory process, complicating the possibility of improving the wellbeing of the patient.
Calorie Restriction (Anti-Inflammatory)
High-calorie intake and a meal rich in refined carbohydrates and sugar increase insulin level and favors biosynthesis, including the production of proinflammatory molecules and the production of free radicals. Calorie restriction, obtained by decreasing food intake or by intermittent fasting (one day and the other not), upregulates the level of SIRT1 (Zhang et al., 2011), increases the level of AMP and upregulates AMPK, increases adiponectin levels and upregulate or activate its receptors (Lee and Kwak, 2014), and downregulates oxidative damage, lymphocyte activation, and the progression of experimental models of MS (Piccio et al., 2008, 2013). The effects of calorie restriction can be mimicked by agonists (resveratrol and other polyphenols), acting on the same targets (SIRT1, AMPK).
Physical Exercise (Anti-Inflammatory)
Physical exercise is now an almost accepted practice also for MS patients and is commonly applied in order to decrease the symptoms of chronic fatigue and prevent or slow the onset of disability. However, the importance of physical exercise goes beyond that of simple muscle activity and should be rather considered in a holistic context in which diet, exercise, therapy, and social interchange, all play a role for the wellness of MS patients (Gacias and Casaccia, 2013).
Dietary control and exercise practice have been proposed by the WHO (2010) to attenuate or prevent human chronic diseases.
From a molecular point of view, physical exercise exerts its beneficial effect by acting on the protein kinase AMPK axis and the AMPK�Sirtuins�PPAR-? network, upregulating oxidative metabolism and downregulating biosynthetic pathways and inflammation (Narkar et al., 2008). As AMPK has a key role in energy balance, it is important to mention its agonists. Resveratrol and AMPK agonists such as metformin, a drug used in type 2 diabetes, can mimic or enhance the effect of physical activity and are effective in experimental encephalitis (Nath et al., 2009).
Physical exercise influences the quality of life and may stimulate the production of anti-inflammatory cytokines (Florindo, 2014). Furthermore, physical exercise lowers plasma levels of leptin and reduces gene expression of leptin receptors in the liver (Yasari et al., 2009), while increasing adiponectin levels and adiponectin receptors activity (Lee and Kwak, 2014).
The association of physical exercise with calorie restriction leads to a significant reduction of inflammatory markers (Reed et al., 2010).
Recent studies carried on adult C57BL/6 J male mice have shown that exercise stimulate brain mitochondrial activity, potentiate neuroplasticity, and is associated to mood improvement, as it decrease anxiety-like behaviors in the open field and exert antidepressant-like effects in the tail suspension test (Aguiar et al., 2014). Other studies performed on rats showed that exercise can alter the composition and diversity of gut bacteria (Petriz et al., 2014).
On these grounds, MS patients should practice mild physical exercise (brisk walking, swimming, or even dancing), if possible in the course of a rehabilitation program.
Nutritional Clinical Trials in MS So Far
Unfortunately, nutritional clinical trials in MS are only very few. Some of them were based on diets low in saturated fat, either without supplements (Swank and Goodwin, 2003) or with omega-3 fat supplements (Nordvik et al., 2000; Weinstock-Guttman et al., 2005). Other clinical trials were based on the administration of single dietary supplements only: either vitamin D, or fish oil (n-3 PUFA), or lipoic acid. Clinical trials with single polyphenols were performed only in cancer. Dietary supplements have never been used together and have never been associated with dietary prescription.
Taken together, clinical attempts to clarify the role of nutrition in MS were considered only promising of poor quality or with no clear results (Farinotti et al., 2007, 2012). In particular, as reported by Farinotti et al. in their Cochrane review (2012), supplements such as n-3 PUFA seem to have no major effect on the main clinical outcome in MS, but they may reduce the frequency of relapses over 2 years. Data available were considered to be insufficient or of uncertain quality to assess a real effect from PUFA supplementation. In some studies, slight possible benefits in relapse outcomes were found with omega-6 fatty acids, but data were characterized by the reduced validity of the endpoints. In general, trial quality was found to be poor. Studies on vitamin supplementation were not analyzed as none met the eligibility criteria, mainly due to lack of clinical outcomes. Thus, evidence on the benefits and risks of vitamin supplementation and antioxidant supplements in MS is lacking.
Suggestions for a Nutritional Intervention in MS: The Choice of Diet and Dietary Supplements
At the end, the goal of a nutritional intervention in MS must be the control of inflammation and this, as shown in this review, can be achieved mainly by controlling postprandial inflammation, the composition of gut microbiota and intestinal and systemic inflammation, and immunity. This can be achieved by a long-term dietary intervention, with a hypocaloric diet, prebiotics, probiotics, and dietary supplements.
As reported in this article, healthy dietary molecules, calorie restriction, and exercise are able to direct cell metabolism toward catabolism and downregulate anabolism and inflammation by interacting at different levels with specific enzymes, nuclear receptors, and transcriptional factors. Furthermore, in association with fiber, they can shift gut dysbiosis to eubiosis.
As a result, low-calorie meals (1,600�1,800 kcal) based on vegetables, whole cereals, legumes, fruit, and fish may slow down the progression of the disease and ameliorate the wellness of MS patients, whereas hypercaloric diets with high intake of salt, saturated animal fat, fried food, and sugar-sweetened drinks may lead to the onset of postprandial inflammation and systemic low-grade inflammation.
Diet should be integrated with prebiotics, probiotics, specific vitamins (D, A, B12, and nicotinic acid), oligoelements (magnesium and selenium), and dietary supplements such as polyphenols, n-3 PUFA, and lipoic acid.
Prebiotics for MS should include inulin, bran, lactosucrose, and oligofructose, preferential nutrients for colonocytes and capable to inactivate NF-kB. Probiotics, such as lactococcus lactis, bifidobacterium lactis, and clostridium butyricum, which can improve the intestinal microbial balance, can be used to change the composition of colonic microbiota. The combination of prebiotics and probiotics is highly recommended. Bowel functions and weight should always be under control.
A more drastic therapeutic approach aimed to restore gut eubiosis and downregulate inflammation may be represented by fecal microbiota transplantation (FMT; Smits et al., 2013). The method seems to be very effective but still primitive, not completely safe, and in a way also disgusting. The field should move beyond fecal transplants, identify the organisms that may be essential for a particular condition, and provide those organisms in a much simpler fashion than FMT (�Critical Views in Gastroenterology & Hepatology,� 2014).
Dietary supplements, with the only exception of omega-3 PUFA, which are normal constituents of our body, are useful at the beginning of the nutritional intervention, or in the course of relapses, to facilitate the recovery of a healthy condition, but their use should be restricted to only a limited period of time (3�4 months). This is particularly valid for the polyphenols. Polyphenols are not well-known molecules with regard to their bioavailability and their biological effects and special precautions should be used when supplementing the diet with them. On one hand, they can downregulate the synthesis of proinflammatory molecules in the course of inflammatory processes; on the other hand, they can stimulate cell activity in resting cells, but a persistent stimulation can induce the apoptosis of healthy cells. Taken together, these considerations suggest that administration of purified polyphenols should be performed on the basis of preliminary clinical trials to test their effectiveness as dietary supplements and to determine their long-term safety and the right dosage.
In general, a nutritional intervention with anti-inflammatory food and dietary supplements decreases the biosynthesis of proinflammatory compounds and therewith makes more effective the use of immune-modulatory drugs, and eventually might limit their possible adverse effects, alleviate the symptoms of chronic fatigue syndrome, and favor patient wellness. However, diet and dietary supplements should not be treated as drugs and as a substitute of therapy. Similarly, proinflammatory food is not toxic and there is no need to exclude it completely. You can eat a nice steak or fried food without risk or guilt, if you are in a basically healthy condition. What hurts are the wrong eating habits in the long run.
Multiple sclerosis, or MS, is a chronic, progressive disease involving damage to the myelin sheaths of nerve cells. The epidemiology of MS suggests that various factors are often involved in the clinical expression of the health issue. However, numerous research studies have primarily evaluated the role of diet on the development of multiple sclerosis. For several years, healthcare professionals believed there was a correlation between the consumption of dairy in patients with multiple sclerosis. According to various research studies, a significant correlation between cow milk and the prevalence of multiple sclerosis was found, suggesting a possible role of dairy products in the multifactorial etiology of MS. Dr. Alex Jimenez D.C., C.C.S.T.
Conclusions
So, at first glance, MS does not seem to have any of the characteristics of chronic inflammatory diseases, which could be related to wrong dietary habits and lifestyle, or even to a dysbiotic gut microbiota. There is apparently nothing in an exacerbation of the disease that may be linked to food or the state of the intestinal microbiota. In fact, when we began our studies on the impact of nutrition on MS, there was not even the slightest clue that there could exist a real link between them, and the idea of the involvement of gut microbiota in MS was considered only very speculative. To date, the idea that dietary habits might influence the course of MS is still struggling to establish itself. Not so in cardiovascular diseases and other chronic inflammatory conditions, in which the influence of dietary habits is almost accepted, and not even in cancer, which is increasingly considered as a metabolic disorder (Seyfried et al., 2014).
At present, MS therapy is not associated to any particular diet, probably due to lack of information on the effects of nutrition on the disease. However, the majority of patients with MS is looking for complementary and alternative treatments (CAM), and in particular is trying to change dietary habits, almost without the advice of the physician (Schwarz et al., 2008; Leong et al., 2009). A recent study based on data provided by MS patients in response to a questionnaire on their dietary habits seems to support a significant association of healthy dietary habits with better physical and mental health-related quality of life and a lower level of disability (Hadgkiss et al., 2014). These data reinforce the idea of the need for randomized controlled trials of nutritional intervention for people with MS. It should be emphasized that nutritional treatments should be complementary, but not alternative to therapy, be part of a holistic approach and performed under medical control.
As there are no data available from clinical trials yet, our work is aimed to rationalize dietary choices on the basis of known and established effects of dietary factors and lifestyle at the molecular level. Data reported in Figure 2 are obviously not complete but may be useful to provide guidelines for nutritional interventions. In principle, proinflammatory food upregulate the biosynthetic and inflammatory pathways, as shown on the right and at the bottom of Figure 2, whereas anti-inflammatory food upregulates oxidative metabolism and downregulates anabolism and inflammation.
As shown in this article, the finding that calorie restriction, exercise, and particular dietary factors can influence the degree of inflammatory responses by acting on both cellular metabolism (Figure 2) and composition of gut microbiota (Figure 5), suggests that an appropriate nutritional intervention may ameliorate the course of the disease and may be therefore taken in consideration as a possible complementary treatment in MS. As inflammation is present in both RRMS and PPMS, nutritional advices are indicated for both forms of the disease. This is particularly important in the case of PPMS, for which no cure is presently available. Conversely, as specific dietary habits may be detrimental and may promote a chronic state of low-grade inflammation, a wrong diet may be considered a possible contributory cause of relapses in MS.
Taken together, we have now a better knowledge of the possible influence of dietary factors on cell metabolism and gut microbiota, and on their possible effects on the disease, but, clearly, we are only just beginning to understand the role of nutrition and gut microbiota in MS and much work remains in terms of understanding the nature of the interactions of gut microbiota with the host�s immune system, especially at sites distal to the intestine.
On these grounds, future prospects in MS research should regard the following points: (a) assess gut microbiota composition; (b) evaluate defects in intestinal immune system; (c) clarify the role of polyphenols and vitamin D metabolism; (d) study the impact of dietary factors, herbs, and drugs on AMPK, Sirtuins, PPAR, or directly on NF-kB. Noteworthy, some drugs used to treat type II diabetes, such as the PPAR-? agonists thiazolidinediones (Bernardo et al., 2009), and the AMPK agonist metformin (Nath et al., 2009) have anti-inflammatory effects comparable with those of anti-inflammatory dietary factors; (e) define possible interferences between dietary supplements and MS drugs; (f) promote a campaign aimed to educate about the importance to follow a healthy diet during therapy, for instance, encouraging patients to include fiber or complex carbohydrates in their diet, supplementing with probiotics, choosing n-3 fats over proinflammatory n-6 fats, and limiting meat and animal fat consumption. The choice of good recipes, such as those described by Mollie Katzen (2013), can make the diet more acceptable.
Overall, immune-modulatory conventional MS therapies have been almost successful; however, drugs that can protect and favor repair mechanisms are still missing. We can decide to help people stay healthy by providing nutritional guidance and physical activity opportunities. For the moment, there are only good prospects for improving the wellbeing of patients with MS. We are only at the beginning of the story.
Summary
As both relapsing-remitting MS and primary-progressive MS are inflammatory diseases, they can be influenced by proinflammatory or anti-inflammatory dietary habits and lifestyle through their action on cell metabolism and gut microbiota. Nutritional advice to MS patients may favor their wellness.
Declaration of Conflicting Interests
The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work is supported by the Italian Foundation for Multiple Sclerosis (FISM) with grants 2007/R/15 for the Project �Healthy and Functional Foods for MS patients,� 2010/R/35 for the Project �The Molecular Basis for Nutritional Intervention in Multiple Sclerosis,� and 2014/S/2 (2014�2015) for the project �Nutritional Facts in Multiple Sclerosis: Why They Are Important and How They Should Be Managed� to P. R.
Many doctors greatly recommend that patients with multiple sclerosis, or MS, avoid dairy because various research studies have demonstrated a high correlation between MS and dairy, especially cow�s milk. This is largely due to the fact that the proteins in cow�s milk are generally targeted by the immune system of patients with multiple sclerosis. Furthermore, some proteins in cow�s milk imitate part of the myelin oligodendrocyte glycoprotein, or MOG, the section of myelin which triggers the autoimmune response in multiple sclerosis that can trick the immune system to attack and destroy the MOG. Information referenced from the National Center for Biotechnology Information (NCBI). The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Back pain�is one of the most prevalent causes of disability and missed days at work worldwide. Back pain attributes to the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments, and muscles, among other soft tissues. Injuries and/or aggravated conditions, such as�herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief. �
Can exercise slow down the progression of multiple sclerosis? Multiple sclerosis, or MS, is a chronic, neurological disease characterized by damage to the myelin sheaths of nerve cells in the central nervous system, or CNS. Common symptoms of multiple sclerosis include pain, fatigue, vision loss and impaired coordination. Exercise is frequently recommended as a form of treatment for several types of injuries and/or conditions, including MS. While exercise has been determined to help improve the management of symptoms of multiple sclerosis as well as decrease the progression of the disease, further evidence is still required. The purpose of the following article is to demonstrate how exercise can affect disease progression of multiple sclerosis and improve quality of life in patients.
Abstract
It has been suggested that exercise (or physical activity) might have the potential to have an impact on multiple sclerosis (MS) pathology and thereby slow down the disease process in MS patients. The objective of this literature review was to identify the literature linking physical exercise (or activity) and MS disease progression. A systematic literature search was conducted in the following databases: PubMed, SweMed+, Embase, Cochrane Library, PEDro, SPORTDiscus and ISI Web of Science. Different methodological approaches to the problem have been applied including (1) longitudinal exercise studies evaluating the effects on clinical outcome measures, (2) cross-sectional studies evaluating the relationship between fitness status and MRI findings, (3) cross-sectional and longitudinal studies evaluating the relationship between exercise/physical activity and disability/relapse rate and, finally, (4) longitudinal exercise studies applying the experimental autoimmune encephalomyelitis (EAE) animal model of MS. Data from intervention studies evaluating disease progression by clinical measures (1) do not support a disease-modifying effect of exercise; however, MRI data (2), patient-reported data (3) and data from the EAE model (4) indicate a possible disease-modifying effect of exercise, but the strength of the evidence limits definite conclusions. It was concluded that some evidence supports the possibility of a disease-modifying potential of exercise (or physical activity) in MS patients, but future studies using better methodologies are needed to confirm this.
Keywords:disease activity, exercise therapy, physical activity, training
Introduction
Multiple sclerosis (MS) is a clinically and pathologically complex and heterogeneous disease of unknown etiology [Kantarci, 2008]. In 28 European countries with a total population of 466 million people, it is estimated that 380,000 individuals are affected with MS [Sobocki et al. 2007]. The disorder is progressive but more than 80% of all MS patients have the disease for more than 35 years [Koch-Henriksen et al. 1998], the number of years of life lost to the disease being 5 to 10 [Ragonese et al. 2008]. The fact that MS is a chronic, long-lasting and disabling disease makes MS rehabilitation an important discipline in maintaining an independent lifestyle and the associated level of quality of life [Takemasa, 1998]. Despite the fact that MS patients for many years were advised not to participate in physical exercise because it was reported to lead to worsening of symptoms or fatigue, it has become generally accepted to recommend physical exercise for MS patients during the last two decades [Sutherland and Andersen, 2001]. Exercise is well tolerated and induces relevant improvements in both physical and mental functioning of persons with MS [Dalgas et al. 2008]. It is an open question whether exercise can reverse impairments caused by the disease per se, or whether exercise simply reverses the effects caused by inactivity secondary to the disease. However, most likely exercise may reverse the effects of an inactive lifestyle adopted by many patients [Garner and Widrick, 2003; Kent-Braun et al. 1997; Ng and Kent-Braun, 1997; Stuifbergen, 1997]. Nonetheless, it has been suggested that exercise might have the potential to have an impact on MS disease progression by slowing down the disease process itself [Heesen et al. 2006; Le-Page et al. 1994; White and Castellano, 2008b]. In other disorders exercise has been shown to pose the potential to have an impact on brain function and, as recently summarized by Motl and colleagues, exercise in older adults with or without dementia leads to cognitive improvement relative to a control condition [Motl et al. 2011b]. Based on this and the few existing findings in MS patients, Motl and colleagues suggested that exercise may similarly improve cognitive functioning in MS patients. However, in MS it has not been reviewed whether physical exercise has a more general disease-modifying effect.
To gain more insight on this important topic, we therefore conducted a systematic literature search aiming at identifying studies linking exercise (or physical activity) to disease progression in MS patients or in the experimental autoimmune encephalomyelitis (EAE) animal model of MS. A secondary purpose of the review was to discuss possible mechanisms explaining this link if it does exist and to discuss future study directions within this field.
Methods
The included literature was identified through a comprehensive literature search (PubMed, SweMed+, Embase, Cochrane Library, PEDro, SPORTDiscus and ISI Web of Science) that was performed in order to identify relevant articles regarding MS and exercise up to 4 September 2011. The search was performed using the subject headings �exercise�, �exercise therapy�, �physical education and training�, �physical fitness�, �motor activity� or �training� in combination with �multiple sclerosis� or �experimental autoimmune encephalomyelitis�. No limitations regarding publication year and age of subjects were entered. If possible, abstracts, comments and book chapters were excluded when performing the search in the different databases. This search yielded 547 publications. A screening of these publications based on title and abstract revealed 133 publications relevant for further reading. The reference lists of these 133 publications were checked for further relevant publications that were not captured by the search. This resulted in further six publications and in a total of 139 closely read publications. Studies that turned out to be nonrelevant (n = 65), meta-analyses (n = 3), reviews (n = 22), conference abstracts (n = 8) and articles not written in English (n = 2) were excluded from the final analysis (see Figure 1). Relevant cross- sectional and longitudinal studies were included.
According to Goldman and colleagues measures thought to reflect disease progression (or activity) in MS can be evaluated with objective or subjective outcome measures [Goldman et al. 2010]. Objective measures include (1) clinical outcome measures such as the Expanded Disability Status Scale (EDSS) and Multiple Sclerosis Functional Composite (MSFC) and (2) nonclinical measures such as MRI. The subjective measures include (3) patient-reported measures thought to reflect disease progression or disability such as the Late-Life Function and Disability Inventory. Studies applying patient-reported measures that included a measure of physical activity were also included in this category. Furthermore, we added a category containing studies applying (4) the EAE animal model of MS as study population. Based on this framework the localized articles were divided into the following four groups (see Table 1):
�
disease progression evaluated with clinical outcome measures (n = 12);
disease progression evaluated with nonclinical measures (n = 2);
disease progression evaluated with patient-reported measures (n = 10);
disease progression evaluated in animal studies (n = 3).
Results
Disease Progression Evaluated with Clinical Measures
A number of studies evaluating structured exercise interventions lasting from 3 to 26 weeks have included clinical scales reflecting disease progression as an outcome measure. The applied clinical scales include the EDSS [Bjarnadottir et al. 2007; Dalgas et al. 2009; Fimland et al. 2010; Golzari et al. 2010; Petajan et al. 1996; Pilutti et al. 2011; Rodgers et al. 1999; Romberg et al. 2004; White et al. 2004], the MSFC [Pilutti et al. 2011; Romberg et al. 2005], the Guys Neurological Disability Scale (GNDS) [Kileff and Ashburn, 2005; van den Berg et al. 2006] and the Functional Independence Measure (FIM) [Romberg et al. 2005]. Studies applying the EDSS have generally not found any change after either endurance training [Petajan et al. 1996; Pilutti et al. 2011; Rodgers et al. 1999], resistance training [Dalgas et al. 2009; Fimland et al. 2010; White et al. 2004] or combined training interventions [Bjarnadottir et al. 2007; Romberg et al. 2004]. Only one study by Golzari and colleagues evaluating the effects of 8 weeks of combined training (3 days/week) reported an improvement in EDSS score [Golzari et al. 2010]. This finding was not confirmed in a long-term study (26 weeks) [Romberg et al. 2005] also evaluating the effects of combined training. In the study by Romberg and colleagues no effect on EDSS and FIM were found, but a small positive effect was seen in the MSFC. A few studies applied the GNDS with one reporting an improvement after 12 weeks of biweekly endurance training [Kileff and Ashburn, 2005] and one reporting no effects of 4 weeks endurance training completed 3 days a week [van den Berg et al. 2006].
In summary, structured exercise intervention studies of different exercise modalities lasting 3�26 weeks have generally found no effects on EDSS scores. A few exercise studies have shown positive effects when applying other clinical scales (MSFC and GNDS).
Disease Progression Evaluated with Non-Clinical Measures
Two studies by Prakash and colleagues have evaluated the effects of cardiorespiratory fitness on brain function and structure by applying (functional) MRI [Prakash et al. 2007, 2009]. One study [Prakash et al. 2007] investigated the impact of cardiorespiratory fitness on cerebrovascular functioning of MS patients. Twenty-four female participants with relapsing�remitting MS were recruited for the study and all participants went through fitness assessment (VO2 peak) and were scanned in a 3-T MRI system while performing the Paced Visual Serial Addition Test (PVSAT). Higher fitness levels were associated with faster performance during the PVSAT that could be related to greater recruitment of a specific region of the cerebral cortex (right inferior frontal gyrus [IFG] and middle frontal gyrus [MFG]) known to be recruited by MS patients during performance of PVSAT to purportedly compensate for the cognitive deterioration attributable to MS. In contrast, lower levels of fitness were associated with enhanced activity in the anterior cingulate cortex (ACC), thought to reflect the presence of a larger amount of conflict increasing the potential for error in lower fit MS participants. The authors interpreted the results as supporting aerobic training as an intervention to support the development of additional cortical resources in an attempt to counter the cognitive decline resulting from MS. Among a number of cognitive tests, only the Paced Auditory Serial Addition Test (PASAT) showed a weak correlation (p = 0.42) to VO2 peak leading the authors to suggest that fitness does not have an influence on measures of general cognitive functioning.
In another study by Prakash and colleagues the relationship between cardiorespiratory fitness (VO2 max) and measures of gray matter atrophy and white matter integrity (both of which have been associated with the disease process) were studied [Prakash et al. 2009]. A voxel-based approach to analysis of gray matter and white matter was applied on brainscans from a 3-T MRI system. More specifically it was examined whether higher levels of fitness in 21 female MS patients were associated with preserved gray matter volume and integrity of white matter. A positive association between cardiorespiratory fitness and regional gray matter volumes and higher focal fractional anisotropy values were reported. Both preserved gray matter volume and white matter tract integrity were associated with better performance on measures of processing speed. Recognizing the cross-sectional nature of the data, the authors suggested that fitness exerts a prophylactic influence on the structural decline observed early on, preserving neuronal integrity in MS, thereby reducing long-term disability.
In summary, (f)MRI studies suggesting a protective effect of cardiorespiratory fitness on brain function and structure in MS patients have started to emerge. However, the cross-sectional nature of the few existing studies limit conclusions regarding the existence of a causal relationship.
Disease Progression Evaluated with Patient-Reported Measures
A number of studies have addressed the relationship between exercise or physical activity and disease progression in large-scale questionnaire studies applying patient-reported measures.
In a large descriptive longitudinal survey study, Stuifbergen and colleagues examined the correlations between the change in functional limitations, exercise behaviors and quality of life [Stuifbergen et al. 2006]. More than 600 MS patients completed a number of questionnaires every year for a period of 5 years. The self-reported longitudinal measures were analyzed by applying latent curve modeling. The Incapacity Status Scale provided a measure of functional limitations due to MS, whereas the Health Promoting Lifestyle Profile II provided a measure of exercise behavior. At the first test point (baseline test) cross-sectional data showed a significant negative correlation (r = ?0.34) between functional limitations and exercise behaviors, suggesting that at the start of the study higher levels of functional limitations were associated with lower levels of exercise. Longitudinal data from the study showed that increasing rates of changes in functional limitations correlated with decreasing rates of change in exercise behaviors (r = ?0.25). In other words these findings are suggesting that increases in exercise behaviors correspond with decreased rates of change in functional limitations. No correlation between the initial degree of limitation and continuing rate of exercise was found which led the authors to suggest that persons with MS with varied levels of limitations might slow the trajectory of increasing limitations over the long term with consistent exercise participation.
A series of studies from Motl and colleagues have addressed the relationship between physical activity, symptoms, functional limitations and disability in MS patients. In a cross-sectional study [Motl et al. 2006] in 196 MS patients, the number of symptoms within 30 days (MS-related Symptom Checklist) and physical activity (Godin Leisure-Time Exercise Questionnaire and 7-day accelerometer data) were collected. After modeling data a direct relationship between symptoms and physical activity were found (r = ?0.24) indicating that a greater number of symptoms resulted in lower amounts of physical activity. However, the authors noted that the cross-sectional design precludes inferences about the direction of causality, and physical activity might affect symptoms as symptoms affect physical activity participation. When modeled this way a moderate inverse correlation between physical activity and symptoms was found (r = ?0.42) indicating fewer symptoms when the physical activity level is high. This led the authors to suggest the existence of a bi-directional relationship between physical activity and symptoms.
In a following questionnaire study Motl and colleagues examined physical activity (Godin Leisure-Time Exercise Questionnaire and 7 day accelerometer data) and symptoms (Symptom Inventory and MS-related Symptom Checklist) as correlates of functional limitations and disability (Late-Life Function and Disability Inventory) in 133 MS patients [Motl et al. 2007, 2008b]. A model based on the disablement model proposed by Nagi (1976) was tested as the primary model and this showed that physical activity and symptoms were negatively correlated (r = ?0.59) and those who were more physically active had better function (r = 0.4). Furthermore, those with better function had less disability (r = 0.63) which led the authors to conclude that the findings indicate that physical activity is associated with reduced disability (through an association with function) consistent with Nagi�s disablement model (Nagi 1976), but again the cross-sectional design limited definite conclusions on the direction of the relationships.
Motl and colleagues then published a longitudinal (case report) study examining the relationship between worsening of symptoms and the level of physical activity throughout a 3- to 5-year period [Motl et al. 2008a]. The study showed that worsening of symptoms (interview) was significantly associated with lower levels of self-reported physical activity (International Physical Activity Questionnaire [IPAQ]) in a group of 51 subjects with MS. The study supports symptoms as a possible explanation for the rate of physical inactivity among MS patients but the direction of the cause and effect relationship could still not be established. Based on the results the authors suggest that managing symptoms might be important for the promotion of physical activity, but also that symptoms may be both an antecedent and consequence of physical activity.
After that Motl and colleagues published a cross-sectional study examining the correlation between physical activity and neurological impairment and disability in a group of 80 MS patients [Motl et al. 2008c]. Physical activity (7-day accelerometer day), impairment and disability (Symptom Inventory and self-reported EDSS) was measured and significant correlations were found between physical activity and both EDSS (r = ?0.60) and Symptom Inventory (r = ?0.56). The authors concluded that physical activity was associated with reduced neurological impairment and disability, but also stated that no causal relationship could be established due to the cross-sectional nature of the study.
Motl and McAuley then published a large-scale longitudinal questionnaire study examining the changes in physical activity (Godin Leisure-Time Exercise Questionnaire and 7-day accelerometer data) and symptoms (Symptom Inventory and MS-related Symptom Checklist) as correlates of changes in functional limitations and disability (Late-Life Function and Disability Inventory) [Motl and McAuley, 2009]. A total of 292 MS patients were followed for 6 months. Again a model based on the disablement model proposed by Nagi (1976) was tested as the primary model and this showed that change in physical activity was associated with residual change in function (r = 0.22) and change in function was associated with residual change in disability (r = 0.20). This led the authors to conclude that the findings indicate that change in physical activity is associated with change in disability (through an association with function) consistent with Nagi�s disablement model, but other models may be applied during analysis and a causal interpretation, therefore, still could not be adopted.
In a 6-month longitudinal study Motl and colleagues then tested the hypothesis that a change in physical activity (Godin Leisure-Time Exercise Questionnaire and International Physical Activity Questionnaire) would be inversely associated with a change in walking impairment (Multiple Sclerosis Walking Scale-12) in patients with relapsing�remitting MS [Motl et al. 2011a]. Data from 263 MS patients were analyzed using linear panel analysis and covariance modeling. Findings showed that a standard deviation unit change of 1 in physical activity was associated with a standard deviation unit residual change of 0.16 in walking impairment. These findings, therefore, support physical activity as an important approach, when trying to avoid walking impairments.
Finally, Motl and McAuley published a paper on longitudinal data (6 months) from 292 MS patients evaluating the relationship between a change in physical activity (7-day accelerometer data) and change in disability progression (Patient Determined Disease Steps Scale) [Motl and McAuley, 2011]. Panel analysis showed that a change in physical activity was associated with a change in disability progression (path coefficient: �0.09). This led the authors to conclude that a reduction in physical activity is a behavioral correlate (but not necessarily a cause) of short-term disability progression in persons with MS.
Recently, Tallner and colleagues evaluated the relationship between sports activity (Baecke Questionnaire � sports index) and MS relapses during the last 2 years (based on self-reports) in 632 German MS patients [Tallner et al. 2011]. Patients were divided into four groups based on their sports index. The study showed no overall differences between the four groups concerning the number of relapses within the last 2 years. However, the most active group had the lowermost mean and standard deviation of all groups. Consequently, these data suggest that exercise does not negatively influence relapse rate and the data further indicate that exercise actually reduce relapse rate.
In summary, patient-reported measures of the association between exercise or physical activity and disease progression (expressed as symptoms, functional limitations or disability) or activity (relapse rate) provide evidence of an association with more physical activity providing protection. However, due to the nature of the studies the causality of this association has not been established.
Disease Progression Evaluated in Animal Studies
Some obvious methodological difficulties exists in designing a human study clarifying whether or not exercise has an impact on disease progression in MS patients. Therefore, the question has been addressed in the EAE animal model of MS.
In a preliminary study by Le-Page and colleagues four groups of EAE rats were followed from day 1 to day 10 after injection with an agent inducing EAE [Le-Page et al. 1994]. The injection resulted in three different disease courses in the rats, namely acute (rats rapidly developed serious clinical signs and died without signs of recovery), monophasic (rats developed only one bout of disease followed by complete recovery) and chronic relapsing (CR-EAE, more than one bout of disease followed by remission). The CR-EAE disease course is characterized by the development of an initial acute paralytic attack 10�20 days after immunization with neuroantigens and the development of spontaneous relapses thereafter. A female and a male group of rats exercised and a female and male group served as control. Exercise consisted of running on a treadmill from day 1 to day 10 after injection. The protocol was progressively adjusted with the duration increasing from 60 min towards 120 min and the running speed increasing from 15 to 30 m/min. The study showed that in the exercised CR-EAE rats of both sexes the onset of the disease was significantly delayed compared with the onset in control CR-EAE rats. Also, the duration of the first relapse was significantly reduced in exercised CR-EAE rats compared with control rats whereas no effect was seen on the peak severity of the disease. No effects of exercise were observed in the acute and monophasic EAE rats. The authors concluded that endurance exercise during the phase of induction of EAE diminished lightly one type of EAE (CR-EAE) but also that exercise did not exacerbate the disease.
In a complementary study Le-Page and colleagues conducted further four experiments in the monophasic EAE model [Le-Page et al. 1996]. Experiments 1 and 2 showed that 2 consecutive days of intensive exercise (250�300 min/day) performed just after injection had a lowering effect on the course of the clinical signs of disease as compared with control rats. Also, the onset of the disease and the day of maximal severity were both delayed in the exercising rats, whereas no change was observed in disease duration. When the 2 consecutive days of exercise were performed before injection no effects were observed. In experiments 3 and 4 it was tested how 5 days of more moderate exercise at either constant (15�25 m/min for 2 hours) or variable speed (3 min at 2 m/min and then 2 min at 35 m/min for a total of 1 hour) affected the course of the disease and the clinical parameters. No effects were observed on the disease course and on the clinical parameters. The authors concluded that severe exercise contrary to more moderate exercise slightly influenced the effector phase of monophasic EAE, and confirmed that physical exercise performed before onset of EAE did not exacerbate the clinical signs.
More recently, Rossi and colleagues further explored the effects of physical activity on disease progression in the CR-EAE mice model [Rossi et al. 2009]. In this study one group of mice had their cage equipped with a running wheel on the day of immunization, while the control group had no running wheel. The amount of physical activity was not controlled and it was therefore the amount of voluntary physical activity in the running wheel that constituted the intervention. In a further experiment EAE mice in standard cages were compared with EAE mice in cages equipped with a blocked wheel. This was done to dissect the role of physical activity from that of sensory enrichment caused by the wheel itself, and showed not to influence the clinical course of the disease. During the initial phase (13 days after injection) of the disease the exercising mice ran spontaneously an average of 760 turns/day in the running wheel which dropped to 18 turns/day when motor impairment peaked (20�25 days after injection). The study showed that the severity of EAE-induced clinical disturbances was attenuated in both acute and chronic phases of EAE in the physically active mice, who consistently exhibited less severe neurological deficits compared with control EAE animals during a time period of 50 days after EAE induction. Furthermore, it was shown that both synaptic and dendritic defects caused by EAE were attenuated by physical activity.
In summary, aerobic exercise (or voluntary physical activity) has the potential to influence the clinical course of the disease in the EAE animal model of MS.
Participating in physical activities and exercise can be beneficial for anyone, especially for people with multiple sclerosis, or MS. Exercise can help ease multiple sclerosis symptoms, however, patients have to be careful with the amount of physical activity they engage in. Several research studies like the one discussed in this article have determined that physical activities and exercises can help improve symptoms as well as slow down the progression of multiple sclerosis. It’s essential to talk to a healthcare professional to discuss the details of each workout program in order to make the best of the benefits of exercise for MS. Dr. Alex Jimenez D.C., C.C.S.T.
Discussion
Recent evidence from studies applying nonclinical and patient-reported measures as well as from studies applying the EAE animal model of MS indicate a possible disease-modifying effect of exercise (or physical activity) but the strength of the evidence limits definite conclusions. Furthermore, these findings are not confirmed in intervention studies evaluating disease progression by clinical outcome measures. Despite the obvious associated difficulties future long-term exercise intervention studies in a large group of MS patients are needed within this field.
MS Disease Progression
Some major methodological problems arise when trying to measure MS disease progression. The ideal MS outcome measure would quantify irreversible sustained disease progression, but in MS this has proven difficult. The pleiotropic expression of MS makes it challenging to measure all facets of the disease and it may be necessary to focus on specific symptoms. Furthermore, great patient heterogeneity, population variability in the disease course and tempo of progression, subclinical MRI changes of uncertain impact on delayed disability progression, multifaceted neurological deficits with varied abilities for individual patients to compensate and patient comorbidities complicate things further [Goldman et al. 2010].
Clinical Outcome Measures
EDSS, MSFC and relapse rate are the standard clinical outcome measures for MS therapeutic trials and the most widely used measure of disease progression is the EDSS [Goldman et al. 2010]. Our literature review shows that exercise studies (resistance, endurance and combined training) applying EDSS generally do not report any change after an exercise intervention. In medical studies applying EDSS, large sample sizes and interventions lasting 2�3 years are typically required to measure changes in exacerbation rates between treatment and placebo [Bates, 2011]. This corresponds poorly to the short intervention periods (3�26 weeks) and the small sample sizes applied in most exercise studies. This is due to the overall low responsiveness and sensitivity to change of the EDSS as reported in a number of studies (for references see Goldman et al. [2010]). Also, the EDSS have been criticized for its noninterval scaling, emphasis on ambulation status and absence of adequate cognitive and visual components [Balcer, 2001]. Despite the emphasis on ambulation and that a recent meta-analysis concluded that exercise impacts walking positively [Snook and Motl, 2009], no changes were seen in the EDSS in most of the reviewed studies, indicating low scale responsiveness towards exercise interventions. In clinical trials the MSFC is claimed to be more sensitive to change than the EDSS [Goldman et al. 2010]. This suggestion is supported by the finding from one exercise study applying both the EDSS and the MSFC. In this long-term study (26 weeks) [Romberg et al. 2005] the effects of combined training on EDSS and MSFC were evaluated. Only the MSFC showed a significant effect which led the authors to conclude that the MSFC was more sensitive than the EDSS in the detection of improvement of functional impairment as a result of combined exercise. In future exercise studies evaluating disease progression it should therefore be considered to add the MSFC as a clinical outcome measure.
In addition to low scale responsiveness, short-term interventions and small sample sizes other explanations for the general lack of effects on clinical outcome measures can be hypothesized. Despite no clear pattern in the existing data, the type of exercise (e.g. endurance versus resistance training) may influence the effect captured by clinical scales. Also, most studies have evaluated mild to moderately impaired (EDSS <6) MS patients. Perhaps the clinical scales would be more sensitive to change in more severely impaired patients. Finally, findings can be biased if it is generally more physically fit patients that accept to be enrolled in exercise studies. If so, the baseline fitness level may be above average in these patients further lowering the possibility of a change on clinical scales with low responsiveness.
Only a few studies [Bjarnadottir et al. 2007; Petajan et al. 1996; Romberg et al. 2004; White et al. 2004] present clear data on relapse rate but due to the short intervention periods and the small sample sizes in most studies changes in the relapse rate, would not be expected to be evident. However, Romberg and colleagues found a total of 11 relapses (five in the combined training group and six in the control group) during a 6-month intervention period [Romberg et al. 2004]. Similarly, Petajan and colleagues (endurance training group four relapses and control group three relapses) [Petajan et al. 1996] and Bjarnadottir and colleagues (combined training group one relapse and control group one relapse) [Bjarnadottir et al. 2007] reported identical relapse rates in exercise and control groups. In the study by White and colleagues no participants experienced relapses during the 8-week intervention evaluating resistance training [White et al. 2004]. Recently, Tallner and colleagues collected self-report questionnaires on relapse rates and physical activity from MS patients to examine the relationship of different levels of sports activity and relapses [Tallner et al. 2011]. Based on these data the authors concluded that exercise had no significant influence on clinical disease activity. Taken together the few existing data do not indicate that any type of exercise increases relapse rate among MS patients. However, these data should be interpreted with caution due to the small number of participants (not stratified according to disease type or severity) and the short intervention periods in most studies. Consequently, future long-term studies with a large number of participants should, therefore, include relapse rate as an outcome measure.
Nonclinical Measures
Application of MRI has revolutionized the diagnosis and management of patients with MS [Bar-Zohar et al. 2008]. In regard to clinical trials, MRI offers several advantages over the accepted clinical outcome measures for MS, including an increased sensitivity to disease activity and a better association with histopathology findings. Also, MRI provides highly reproducible measures on ordinal scales, and the assessment of MRI can be performed at the highest degree of blinding [Bar-Zohar et al. 2008]. Consequently, a surrogate MRI measure reflecting disease progression such as lesion activity (gadolinium-enhanced lesions and new or enlarged T2-hyperintense lesions) or disease severity (total T2-hyperintense lesion volume, total T1-hypointense lesion volume and whole-brain atrophy) [Bermel et al. 2008] may reduce the required sample sizes needed to evaluate the effects of exercise therapy on disease progression considerably. Until now only two cross-sectional studies have evaluated the effects of exercise (expressed as the current cardiorespiratory fitness level) on different MRI measures limiting the conclusions that can be drawn from this type of study. However, the promising findings do encourage the inclusion of MRI as an outcome measure, in future longitudinal trials evaluating the effects of exercise on disease progression.
Patient-Reported Measures
Patient-reported measures of the association between exercise or physical activity and disease progression (expressed as symptoms, functional limitations or disability) provide evidence of an association with more physical activity providing protection. However, the nature of the studies does not allow conclusions on the causality of this association. In the group of studies applying patient-reported measures we decided to include not only measures of exercise, but also measures of physical activity. It is acknowledged that a measure of physical activity is not necessarily a surrogate measure of exercise, but the many interesting findings from particularly the group of Motl and colleagues caused this. In a recent paper, based on their own studies, Motl and colleagues concludes that recent research has identified physical activity as a behavioral correlate of disability in MS. This made the authors suggest, that physical activity might attenuate the progression of what they call �mobility disability� by improving physiological function in persons with MS, particularly those who have achieved a benchmark of irreversible disability (EDSS >4) [Motl, 2010]. It might be more cost effective to offer the more disabled (EDSS >4) MS patients exercise therapy, but it must be noted that most exercise studies do not indicate that a relationship between the degree of training adaptation and neurological disability exist. In fact, studies indicate that MS patients with an EDSS score below 4.5 experience the largest improvements after a period of endurance training as compared with more disabled MS patients [Ponichtera-Mulcare et al. 1997; Schapiro et al. 1988] or that no differences exists [Petajan et al. 1996]. It must be noted that none of these studies were powered to evaluate the effects of exercise in MS patients with different levels of disability. However, a recent study by Filipi and colleagues specifically evaluated whether 6 months of resistance training improves strength in MS patients with different levels of disability (EDSS 1�8) and concluded that all individuals with MS, despite different disability levels, showed parallel improvement in muscle strength [Filipi et al. 2011]. This leads to the suggestion, that exercise may be equally important during the early phases of the disease, also in regard to impact on disease progression.
An important advantage of applying patient-reported measures is the opportunity to collect data from large sample sizes in longitudinal studies. Furthermore, it seems important to collect data on patient perspective when evaluating the effects of exercise on disease progression. Future studies including patient-reported measures should also include clinical and/or nonclinical outcome measures if possible.
Animal Studies
Our review showed that aerobic exercise (or activities) has the potential to influence the clinical course of the disease in the EAE animal model of MS. The obvious question is whether or not the findings from the EAE animal model of MS can be extrapolated to humans. At the moment no clear answer can be given to this question. A recent review summarized whether the current disease-modifying treatments are justified on the basis of the results of EAE studies. Here it was concluded that although EAE is certainly an imperfect mirror of MS, many clinical, immunopathological and histological findings are impressively replicated by animal models, making EAE invaluable in elucidating the basic immunopathological mechanisms of MS and providing a testing ground for novel therapies [Farooqi et al. 2010]. Consequently, a direct transfer of findings into human subjects cannot be made, but testing of difficult hypotheses can start here. Also, it should be noted that in EAE you cannot control the relative exercise intensity since no maximal exercise test (such as a VO2 max test) can be performed. As a consequence the applied relative exercise intensity may differ between animals. This is also why it is very difficult to evaluate the effects of aerobic exercise on aerobic capacity in EAE. Nonetheless, the EAE model offers a number of advantages compared to human studies. In addition lower costs, easy control with adherence to the intervention and controlled environmental and genetic factors the EAE model also allows evaluation of possible mechanisms located in the central nervous system (CNS), which should have attention in future studies. Another review stated that the genetic heterogeneity, which is so critical in the MS population, is only reflected when multiple different models of EAE are studied in parallel [Gold et al. 2006]. This aspect should also be incorporated in future studies.
Possible Mechanisms
Several mechanisms have been proposed as a possible link between exercise and disease status in MS. Some of the most promising candidates include cytokines and neurotrophic factors [White and Castellano, 2008a].
Cytokines. Cytokines play an important role in the pathogenesis of MS and are a major target for treatment interventions. In particular, interleukin (IL)-6, interferon (IFN)-? and tumor necrosis factor (TNF)-? have a prominent role in the process of demyelination and axonal damage experienced by persons with MS [Compston and Coles, 2008].
Changes in the concentrations of certain cytokines, in particular IFN-? and TNF-?, have been associated with changes in disease status in MS, and elevated concentrations of pro-inflammatory Th-1 cytokines (such as TNF-?, IFN-?, IL-2 and IL-12) may contribute to neurodegeneration and disability [Ozenci et al. 2002]. This has led to the suggestion that exercise may counteract imbalances between the pro-inflammatory Th1 cytokines and the anti-inflammatory Th2 cytokines (such as IL-4 and IL-10) by enhancing anti-inflammatory mechanisms, and thereby potentially be able to alter the disease activity in MS patients [White and Castellano, 2008b].
In MS both the acute and/or chronic effects of resistance [White et al. 2006], endurance [Castellano et al. 2008; Heesen et al. 2003; Schulz et al. 2004] and combined training [Golzari et al. 2010] on several cytokines have been evaluated. A study by White and colleagues reported that resting levels of IL-4, IL-10, C-reactive protein (CRP) and IFN-? were reduced, while TNF-?, IL-2 and IL-6 levels remained unchanged after 8 weeks of biweekly resistance training [White et al. 2006]. These results suggest that progressive resistance training may have an impact on resting cytokine concentrations and, thus, could have an impact on overall immune function and disease course in individuals with MS. However, the study was not controlled and only 10 participants were included obviously limiting the strength of the evidence. Heesen and colleagues evaluated the acute effects of 8 weeks of endurance training on IFN-?, TNF-? and IL-10 and compared this to both a waitlist MS control group and a group of matched healthy subjects [Heesen et al. 2003]. After completing 30 minutes of endurance training (cycling) an increase in IFN-? were induced similarly in all groups while trends towards smaller increases in TNF-? and IL-10 were observed in the two groups of MS patients. Based on these data the authors concluded, that no deviation in pro-inflammatory immune response to physical stress could be demonstrated in MS patients. These findings, therefore, supports that a single bout of endurance training can influence the cytokine profile at least for a period of time in MS patients. In another publication from the same study Schulz and colleagues were not able to demonstrate any differences between the resting level or the acute IL-6 response after 30 minutes of endurance exercise in the MS training group (8 weeks of bicycling) and the MS control group [Schulz et al. 2004].
A study by Castellano and colleagues evaluated the effects of 8 weeks of endurance training (cycling, 3 days/week) on IL-6, TNF-? and IFN-? in 11 MS patients and 11 healthy matched controls. In MS patients both resting IFN-? and TNF-? was elevated after endurance training whereas no changes were observed in healthy controls [Castellano et al. 2008]. Like in the study by Heesen and colleagues [Heesen et al. 2003], Castellano and colleagues also studied the acute effects of a single bout of endurance training and similarly found no differences when compared to the healthy controls, but in this study no increase in IFN-? and TNF-? were observed in any of the groups contrasting the findings by Heesen and colleagues.
In the most recent study Golzari and colleagues performed a randomized controlled trial (RCT) evaluating the effects of 8 weeks of combined endurance and resistance training on IFN-?, IL-4 and IL-17 [Golzari et al. 2010]. The study showed significant reductions in the resting concentrations of IFN-? and IL-17 in the exercise group, whereas no changes were seen in the control group, but no group comparisons were made.
In summary, no clear pattern can be seen in the reported cytokine responses to exercise probably reflecting large methodological differences between the studies (study type, type of exercise intervention, time of measurements, standardizations, etc.) and a low statistical power which is critical due to the great variation in this type of measurements. Nonetheless, a single bout of exercise have been reported to influence a number of (pro-inflammatory) cytokines in MS patients and also chronic changes in the resting concentration of several cytokines have been reported after a training period. Furthermore, the response seems to be comparable to that of healthy subjects. Cytokines, therefore, may link exercise and disease progression in MS, but large-scale future RCTs have to evaluate this further.
Neurotrophic factors. Neurotrophic factors are a family of proteins that are thought to play a role in preventing neural death and in favoring the recovery process, neural regeneration and remyelination throughout life [Ebadi et al. 1997]. Some of the more well-characterized neurotrophic factors include brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) [White and Castellano, 2008b].
Gold and colleagues evaluated the acute effects of a single exercise bout (30 min cycling at 60% VO2 max) on NGF and BDNF in 25 MS patients and compared this with a group of matched healthy controls [Gold et al. 2003]. The study showed that baseline concentrations of NGF were significantly higher in MS patients compared with controls. Thirty minutes after exercise a significant increase was observed in BDNF while a trend towards an increase in NGF was observed. However, the changes did not differ from the changes observed in the healthy subjects. This made the authors conclude that moderate exercise can be used to induce neutrophin production in subjects with MS possibly mediating the beneficial effects of physical exercise. In a study from the same group Schulz and colleagues evaluated the effects of biweekly cycling for 8 weeks on BDNF and NGF in a RCT in MS patients [Schulz et al. 2004]. The study showed no effects on the resting concentration and on the response to acute exercise after the intervention period, and only a trend towards lower resting NGF levels was found. Castellano and White also evaluated whether 8 weeks of cycling (three times a week), would affect serum concentrations of BDNF in MS patients and in healthy controls [Castellano and White, 2008]. In contrast to the findings of Gold and colleagues, resting BDNF was lower at baseline in MS patients as compared with controls, but no difference (a trend) between groups was found after 8 weeks. In MS patients BDNF concentration at rest was significantly elevated between weeks 0 and 4 and then tended to decrease between weeks 4 and 8, whereas resting BDNF concentration remained unchanged at 4 and 8 weeks of training in controls. Also, the response to a single bout of exercise was evaluated showing a significant reduction in BDNF 2 and 3 hours after exercise in both groups again contrasting with the findings by Gold and colleagues. The authors concluded that their findings provided preliminary evidence showing that exercise may influence BDNF regulation in humans.
In summary contrasting findings on the effects of exercise on neurotrophic factors exists in MS patients, making more studies warranted. However, findings do imply that exercise may influence several neurotrophic factors known to be involved in neuroprotective processes.
Conclusions
It cannot be clearly stated whether exercise has a disease-modifying effect or not in MS patients but studies indicating this do exist. Future long-term intervention studies in a large group of MS patients are therefore needed to address this important question.
Acknowledgments
The authors would like to thank research Librarian Edith Clausen for a substantial contribution to the comprehensive literature search.
Footnotes
This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.
UD has received travel grants and/or honorary from Biogen Idec, Merck Serono and Sanofi Aventis. ES has received research support and travel grants from Biogen Idec, Merck Serono and Bayer Schering and travel grants from Sanofi Aventis.
Multiple sclerosis, or MS, is a chronic disease identified by symptoms of by pain, fatigue, vision loss and impaired coordination caused by damage to the myelin sheaths of nerve cells in the central nervous system, or CNS. Exercise has been demonstrated to help improve the management of symptoms of multiple sclerosis as well as decrease the progression of the disease, although further evidence is still required, the article above summarizes these outcome measures. The purpose of the article above demonstrates how exercise can change the progression of multiple sclerosis and improve overall health and wellness. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Back pain�is one of the most prevalent causes of disability and missed days at work worldwide. Back pain attributes to the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments, and muscles, among other soft tissues. Injuries and/or aggravated conditions, such as�herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief. �
Are you struggling with your symptoms of MS on a regular basis? Multiple sclerosis, or MS, is a disease where the human body’s own immune system attacks the fatty myelin coating which surrounds and insulates nerve cells, a process called demyelination. Common symptoms of multiple sclerosis include fatigue, muscle spasms, walking problems, and tingling sensations and numbness.
According to various research studies, improved strength, flexibility, and mobility from participating in physical activities and exercises help decrease the risk of bone fractures and other ailments in people with MS. One research study also indicates that improper nutrition and a lack of physical activity and exercise are the most frequent risk factors for people with multiple sclerosis.
Another research study on the benefits of exercise for multiple sclerosis was printed by researchers from the University of Utah in 1996. The participants of the research study developed a more positive mindset, increased their strength, flexibility, and mobility, experienced less fatigue, improved their bowel, bladder, and cardiovascular function, and developed fewer symptoms of depression.
Exercises for Multiple Sclerosis
A fitness program ought to be designed under medical supervision and may be adjusted as MS symptoms change. Patients with MS should engage in physical activities and exercises several times each week and avoid workouts for extended periods of time. Patients with MS can still do tasks around the home. Examples of everyday tasks include cooking, gardening, and�other household tasks.
Exercises that can help manage MS symptoms include:
Yoga. This type of physical activity/exercise features becoming aware of your breathing to help relax your body and mind. Benefits of yoga include enhancing the human body’s alignment, improving your own balance. Yoga also teaches you relaxing techniques, like meditation, which you could use during a magnetic resonance imaging, or MRI scan, or receiving an injection.
Tai Chi. This Chinese martial art teaches you how to breathe, relax and slow down your movements. Furthermore, Tai Chi can also help improves your balance, further helping to manage and support muscle tone, as well as help relieves stress.
Water exercises. Physical activities/exercises performed in water require less effort. This helps people with MS move in ways that they would otherwise not be able to perform properly. Benefits of water exercises include muscle relaxation, enhanced flexibility, better movement, improved strength, and reduced pain. These concentrate on improving aerobic resistance.
Healthcare professional used to recommend that people with MS avoid exercise entirely for fear of aggravating their symptoms. Now, evidence indicates that regular exercise not only improves quality of life for people with MS, but it might also help alleviate symptoms and decrease the risk of complications in the future. Exercise can be beneficial for anyone, even for people with multiple sclerosis.
According to many healthcare professionals, physical activity and exercise are one of the most essential elements of treatment for multiple sclerosis or MS. While many patients with MS often avoid exercise, thinking it will aggravate their symptoms, research studies have demonstrated that exercise can actually help improve symptoms. As described in the following article, physical activity can help improve strength, mobility, and flexibility. Furthermore, physical activity can have various other health benefits for MS, including improved bowel and bladder function as well as enhanced mood and decreased fatigue. Dr. Alex Jimenez D.C., C.C.S.T. Insight
Getting Started with Exercise for MS
Kathleen Costello, a nurse practitioner and associate vice president of medical care for the National Multiple Sclerosis Society, recommends seeking the support of a healthcare professional, such as a chiropractor or physical therapist, to determine which physical activities or exercises would be beneficial for patients with MS. Benefits of exercise for multiple sclerosis include:
Less Fatigue
Various kinds of physical activities and exercise can improve fatigue. This is a frequent complaint among individuals with MS. A research study on yoga for people with MS discovered that yoga is as superior as other kinds of exercise in lowering fatigue. Another research study discovered that eight months of water exercise decreased fatigue and improved quality of life in women with MS.
Better Mood
Moderate-intensity exercise, such as brisk walking, dancing, or bicycling, has been shown in several research studies to enhance mood in people who are depressed. One research study discovered that the benefits also apply to adults with neurological disorders, including multiple sclerosis, especially when physical activity guidelines are met. The Centers for Disease Control and Prevention currently recommends that adults get at least 150 minutes, or 2 hours and 30 minutes, of moderate-intensity physical activities or exercises each week, in addition to including at least two workout routines involving muscle strengthening exercises for MS.
Better Bladder Control
Among the research studies on the benefits of exercise in people with MS, one review found that 15 months of aerobic exercise helped to enhance bowel and bladder function in people with MS. A small pilot research study published in the Journal of Alternative and Complementary Medicine in 2014 discovered that a yoga program also afforded better bladder control among individuals with MS.
Stronger Bones
Weight-bearing physical activities and exercise, such as walking, running, or using an elliptical machine, can help strengthen bones and may protect against osteoporosis, a bone-thinning disease that raises the possibility of fracturing bones. A lot of people with MS, or multiple sclerosis, are at risk of developing osteoporosis due to a combination of factors, including:
Low blood levels of vitamin D, the nutritional supplement that works with calcium to protect bone health
A history of taking corticosteroids, drugs used to treat MS flares that can lead to low calcium levels in the bloodstream
Mobility difficulties, which might make a person least likely to engage in different forms of exercise
Low body weight
At the same time, people with MS occasionally have balance conditions which make them more vulnerable to falling, a significant cause of broken bones. Finding a means to take part in exercises and physical activities which can help strengthen the bones is therefore important for preserving bone density and helping to prevent fractures, especially in people diagnosed with MS.
Weight Management
If symptoms of MS result in decreased physical activity or exercise, among one of the consequences, may include weight gain, which can make it even harder for you to get around. The use of corticosteroids can also lead to weight gain. Engaging in physical activities or exercise can help slow down or stop weight gain. Regular exercise can also benefit people who are underweight. Along with other benefits described above, physical activity or exercise may also increase appetite in people who are underweight.
For a lot of people, MS means changes in the physical activities or exercises they can perform and in how they will be able to execute them, however, it doesn’t imply that their lifestyle will come to a standstill. Work with your healthcare professional to discover the actions that suit you best and the assistive devices that could keep you moving with MS. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Curated by Dr. Alex JimenezR
Additional Topic Discussion:�Acute Back Pain
Back pain�is one of the most prevalent causes of disability and missed days at work worldwide. Back pain attributes to the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments, and muscles, among other soft tissues. Injuries and/or aggravated conditions, such as�herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief. �
Participating in regular physical activities and exercises is essential towards maintaining overall health and wellness, however, for approximately 400,000 people in the United States living with multiple sclerosis, exercise can have several benefits worth knowing about. Healthcare professionals used to recommend that patients with multiple sclerosis, or MS, should avoid engaging in physical activities and exercises to prevent aggravating their symptoms. However, research studies suggest that exercise can improve the quality of life of individuals with multiple sclerosis. The purpose of the article below is to demonstrate the effects of exercise in MS.
Abstract
Multiple sclerosis (MS) is the most common chronic inflammatory disorder of the central nervous system (CNS) in young adults. The disease causes a wide range of symptoms depending on the localization and characteristics of the CNS pathology. In addition to drug-based immunomodulatory treatment, both drug-based and non-drug approaches are established as complementary strategies to alleviate existing symptoms and to prevent secondary diseases. In particular, physical therapy like exercise and physiotherapy can be customized to the individual patient’s needs and has the potential to improve the individual outcome. However, high-quality systematic data on physical therapy in MS are rare. This article summarizes the current knowledge on the influence of physical activity and exercise on disease-related symptoms and physical restrictions in MS patients. Other treatment strategies such as drug treatments or cognitive training were deliberately excluded for the purposes of this article.
Keywords:Multiple sclerosis, Physical therapy, Exercise, Prevention of sequelae, Personalized treatment
Background of MS
MS is a chronic inflammatory disease of the CNS, which causes multifocal demyelination along with astrocytic gliosis and variable axon loss in the brain and spine. MS is one of the most common causes of non-traumatic disability in young adults and approximately 1-2.5 million people around the world are estimated to be affected, depending on the publication [1,2]. Women are more likely to develop the disease than men (female:male ratio approximately 2-3:1). MS usually manifests between the age of 20 to 40 years, rarely much earlier during childhood, or in old age. The disease course is usually relapsing-remitting with progression into a secondary progressive form after a varying period of time or primary progressive right from the start. The precise etiology of MS still remains unclear. A combination of environmental and genetic factors which lead to autoimmune reactions against CNS-structures which in turn result in CNS tissue damage and neurological impairment is assumed to be the most likely pathomechanism [2,3].
Depending on the localization and characteristics of the morphological changes in both white and gray brain matter, different symptoms and signs may occur, such as visual impairment, dysarthria and dysphagia, spasticity, paresis, coordination and balance impairment, ataxia, pain, sensory impairment, bladder, bowel and sexual dysfunction [3-7]. Fatigue, emotional and cognitive changes are also frequently present in MS [8-13]. These symptoms, often in combination with a lack of confidence in one’s own capabilities and abilities to manage the symptoms, lead to impaired functional capacity and subsequently reduced physical and sporting activity as well as reduced quality of life [14-18]. As in other conditions with reduced mobility, in MS the lack of physical activity can lead to secondary sequelae such as obesity, osteoporosis, and/or cardiovascular damage which in turn pose a serious threat to patients as they increase the risk of further complications like thrombosis, pulmonary embolisms, upper respiratory or urinary tract infections, or prominent decubital ulcers [15,16,19].
According to the autoimmune etiopathology, immunomodulatory drugs such as interferon-? or glatiramer acetate are the treatment of choice. If these drugs are not sufficiently effective, escalation therapy with immunosuppressive substances (mitoxantrone), monoclonal antibodies (natalizu-mab) or the recently approved sphingosinphosphat receptor modulator fingolimod may be required (Figure 1) [20-22].
Definitions
For the purpose of this article the terms movement, physical activity, exercise, physical function, physical therapy, physiotherapy and sport will be used according to the following definitions (Tables 1 and 2): In terms of the motor system, the term “movement” includes an actively or passively induced change in the position of the body. Regular exercise and physical activity are decisive factors in a person’s quality of life by sustainably improving health and wellbeing and preventing diseases at all stages of life. As opposed to sport, in which the focus is on physical achievement, competition and fun, physical activity encompasses any type of physical movements, which consume energy, regardless of the underlying motivation. The term “health-enhancing physical activity” includes both leisure-time activities (e.g. sport) and everyday activities (e.g. climbing stairs). The intensity of the activity is categorized according to the metabolic equivalent (MET; 1 MET corresponds to the oxygen uptake of an adult whilst sitting = 3.5 ml (men) and 3.2 ml (women) O2/kg/min) into light (<3 MET), moderate (3-6 MET) and vigorous (>6 MET). In contrast to general physical activity, exercise encompasses the planned performance of systematically repeated movements to accomplish skills, maintain and strengthen physical condition, and improve performance. Athletics, more specifically, aims to improve general flexibility and includes endurance training to maintain performance over longer periods of time at a high level and strength training to increase muscle strength. The terms endurance and aerobic training, as well as resistance and strength training, are often used synonymously. Physical function encompasses “a series of increasingly integrated steps, with the highest level consisting of the most advanced activities of daily life (ADL), the fulfillment of societal roles and the pursuit of recreational activities” [16]. The term “physiotherapy” includes manual skills, that are appropriately supplemented by remedies like water, heat, light, or electricity and aims to restore functionality and conscious perception of the human body. Active and/or passive training programs are part of physiotherapeutic methods. On the contrary “physical therapy” is rather used as an umbrella-term, comprising different kinds of physical activity like exercise, (functional) training, physiotherapy, and rehabilitation.
Symptomatic Treatment of MS: Aiming at a Personalized Modification of Symptoms and Outcome
Drug-based and non-drug-based symptomatic treatment approaches for MS complement each other. Drug-based approaches which are referred to in comprehensive reviews [21,22] are beyond the scope of this article. Apart from counseling and nursing care, non-drug strategies encompass physical therapy like physiotherapy, logopedics, occupational therapy including living and mobility aids, sociotherapy and psychotherapy (Figure 1). These measures can be applied multimodally, meaning that several approaches are combined in a patient’s treatment strategy and should generally complement drug therapy [4,23,24]. Physical therapies are developed depending on the individual symptoms and positively affect several factors at the same time. Importantly, apart from reducing symptoms, enhancing mobility, improving quality of life and conferring as much independence as possible, for example by functional training of ADLs, such as washing, eating, drinking, dressing, and performing household chores, symptomatic therapies may prevent potentially life-threatening secondary diseases [15,25]. Physical therapies can be applied in almost every stage of disease — from the first onset of symptoms to highly impaired patients and palliative conditions. In contrast to physiotherapy, exercise is not part of commonly used therapies offered to MS patients; however, it might be a promising and cost-effective tool to improve various functions in patients with MS.
Exercise in MS Patients: Effects on Clinical Parameters (Table 3)
Impairment of MS patients like spasticity or paresis is primarily a consequence of disease progress (morphological changes), but it can be aggravated by reduced physical activity [14,26]. Exercise has been shown to improve various aspects of the physiological profile of MS patients; in particular, inactivity-related impairment can be alleviated by exercise [26]. However, recommendations on exercise for patients with MS have to face a number of limitations: Although there is a large number of studies on which recommendations have been based, many of these studies have limitations, including small sample sizes, lack of an appropriate control group, unblinded design, and failure to distinguish between different courses and stages of the disease. In fact, only occasionally a randomized controlled and blinded study design is applied. Training regimes are often not standardized, and the interventions are hardly sufficiently described. The comparability of studies is furthermore limited by variable treatment duration extending over a short period of weeks up to few months, different treatment frequency and different treatment intensity. Long-term effects of the respective interventions are rarely reported [14,27-31]. Furthermore, the effects of exercise have been studied almost exclusively in MS patients with slight or moderate impairment (score on the expanded disability status scale (EDSS) less than 7) [14]. To our knowledge,only one recently published study examined highly impaired MS patients with an EDSS of 5-8 [32].
In summary, despite the often insufficient methodological quality of the studies and the insufficiently described training regimes [14,29,33] most of these studies including exercise programs of resistance (e.g. progressive resistance exercise, walking mechanics), endurance (e.g. bicycle ergometry, arm or arm-leg ergometry, aquatic exercise, treadmill walking) as well as combined training provided evidence for a benefit of exercise in MS patients [14,15,28,29]. These training programs are referred to in more detail below. All training programs have been well tolerated by the patients. Nearly 100% of inpatient participants and 59-96% participants of home-based trials completed without occurrence of adverse events [34-38].
Endurance Training
Moderate endurance training resulted in improved muscle strength of both lower and upper extremities and some functional measures like walking speed, fatigue, and quality of life [14,15,17,28,29,31,34]. Some authors reported beneficial effects in chair transfer [14,39], gait, stair climbing, and timed up and go test (standing up from a chair, walking 3 m, turning around and seat again) [14,35,40]. But, as described above, varying and contradictory results were found. For example, some authors reported marked improvements in aerobic capacity, measured by maximal oxygen uptake (VO2-max), [14,41,42], whereas others did not observe significant improvements [14,43,44].
The same applies to fatigue as there is some evidence for an improvement of fatigue by endurance training [30,35,45], whereas other studies missed the level of statistical significance [14,28,35] or did not reveal any differences at all [27,46,47].
Contradictory data have been reported on various items of health related quality of life like vitality [14,48], social functioning [14,44,48], mood [14,42,44], energy [14,42], anger [14,41], sexual function [14], bladder and bowel function [41], and depression [14,41].
One group analyzed the effect of a 6 months outpatient aerobic training program in MS patients with mild to moderate disability (EDSS 1-6) and observed a trend for larger benefits in more severely disabled than in less affected patients, but the study is limited by the small sample size of 19 patients of which only 11 patients completed the study [42]. Therefore, these results have to be handled with care and further studies are required.
Resistance Training
Resistance training is known to enhance muscle strength in healthy people. In MS patients there is also evidence for improving muscle strength [35,40]. Furthermore, beneficial effects on walking speed, stepping endurance, stair climbing, timed up and go test, self-reported disability, and self-reported fatigue have been described in MS patients as well as significant improvements in gait disturbances, measured by Dynamic Gait Index [35,49].
There are different forms of resistance training. One form, for example, constitutes progressive resistance exercise (PRE), which according to Taylor et al. comprises the following three principles: “1. perform a small number of repetitions with relatively high loads until muscle fatigue is reached, 2. allow sufficient rest between exercise for recovery, and 3. increase the load as the ability to generate muscle force development” [40].
Cakit et al. examined the effect of PRE by means of cycling progressive resistance training and lower-limb strengthening, both combined with balance exercise in a prospective randomized controlled trial of 45 MS patients [35]. After 8 weeks, patients in the two training groups performed better with respect to 10 m walking test, duration of exercise, and timed up and go test than patients in the control group who received no intervention. Moreover, the training groups showed evidence for superior effects on balance, fatigue, depression, and fear of falling.
Taylor et al. investigated the effect of a 10 week PRE program on maximal muscle force, muscle endurance, functional activity, and overall psychological function in MS patients [40]. The authors reported significant improvements of arm strength, leg endurance, and fast walking speed, and a trend towards improvement in the 2-min walk-test and day-to-day life function.
Besides PRE, other training forms like strategies to promote proper gait mechanics, focusing on weight bearing, weight shifting, and body positioning, or weightlifting are used [49]. For example, Pilutti et al. examined the effect of resistance exercise in six severely disabled patients (EDSS 5-8) with progressive MS (five patients with primary progressive, one patient with secondary progressive disease course) by means of a 12 week course of body-weight supported treadmill training performed three times weekly for 30 min [32]. The patients improved in terms of training intensity treadmill walking speed and required body weight support as well as in physical and mental subscales of a quality of life questionnaire. Fatigue was not reduced.
Combined Endurance and Resistance Training
Only a few authors examined the effect of combined resistance and endurance training in MS. Small improvements both in muscle strength and gait velocity have been described [14,34,50]. Interestingly, in a comparatively large study on 95 MS patients, Surakka et al. observed significant training effects after six months of combined resistance and endurance training only in women, but not in men, which might be explained by a 25% higher exercise activity in women [50]. Furthermore, Romberg et al. reported significant improvements in walking speed and upper extremity endurance following six months combined exercise training, whereas lower extremity strength, VO2-max, static balance, and manual dexterity did not improve [34].
In 2005, the Cochrane Collaboration published a first systematical review on the effects of exercise on ADL and health-related quality of life (HRQoL) and the effects of physical therapy on various symptoms in MS patients [33]. Only controlled, randomized clinical studies on adult MS patients not experiencing an exacerbation at the time were included. Six studies, of which four have so far only been published as an abstract, analyzed the effects of physical therapy (rehabilitation, physiotherapy, exercise, functional training, independent home-based training, aquatic exercise) on several disease-related variables compared to a control group that had not received any physical therapy [36,39,41,51-53]. Three other studies compared the results of two different physical therapy programs. In summary, muscle strength, movement (changing and maintaining posture, walking, moving around, timed transfer, walking cadence), and exercise tolerance tests (modified graded exercise test, VO2-max, and physiological cost index) all showed substantial improvement. Mood parameters (fear, depression) showed only moderate improvement and EDSS, fatigue, cognitive parameters and ADL remained unchanged [18,37,48].
Asano et al. assessed the methodological quality of selected randomized controlled trials (RCT) of exercise interventions in MS carried out from 1950 to 2007 [29]. They found evidence for positive effects of exercise on physical and psychosocial functioning and quality of life, but highlighted a great need for high quality RCTs in this field.
Exercise in MS Patients: the Impact of Body Temperature on Disability
In 1890 the German ophthalmologist Wilhelm Uhthoff (1853-1927) first described visual impairment and paresis occurring after physical activity. Because the patients’ body temperature was not recorded, Uhthoff assumed that the described symptoms were caused by the physical activity itself and not by the resulting increased body temperature. Consequently, MS patients were advised not to engage in exercise [14-16,19,46,54,55]. In fact, 60-80% of MS patients experience a reversible (re)occurrence or aggravation of neurological symptoms in situations with increased body temperature, for example during vigorous physical activity, fever, or a hot bath [14-16,46,54,55]. As a reference to the first description, the eponym “Uhthoff’s phenomenon” has been coined. The underlying cause is thought to be a temperature dysregulation due to dysautonomia with subsequent temperature-dependent impairment of the conduction velocity of partially demyelinated axons [15,16,54,56]. Not until about 1937, numerous systematic investigations revealed the correlation between increased body temperature and aggravation of disability.
Another argument for MS patients to avoid exercise was the assumption that a “waste” of energy might aggravate fatigue and reduce ADLs [14] which however has never been confirmed. Furthermore, a detrimental effect of physical activity itself on CNS structures or an activity-mediated increase of the relapse rate has never been demonstrated [15,57].
Exercise in MS Patients: Effects on the Immune System
It is well known that exercise may influence susceptibility to common infectious diseases like upper respiratory tract infections in different directions [58]. Whereas vigorous physical activity such as competitive sport can lead to an increased susceptibility to infections, moderate exercise may contribute to their prevention [15,19,57-59].
On the immune cell level, physical strain in healthy subjects has been demonstrated to initially increase the peripheral lymphocyte count which subsequently falls to below the initial level after cessation of the physical activity [19,60,61]. The resulting lymphocyte reduction was short-lasting with a maximum duration of 3-24 h [19,58,60] and was shown to be more prominent in Th1 cells than in Th2 cells [61-63]. As Th1 cells primarily secrete pro-inflammatory cytokines like IFN-?, IL-2, and TNF-? whereas Th2 rather secrete anti-inflammatory cytokines such as IL-4, IL-5 and IL-10, exercise can promote a shift from a Th1-mediated pro-inflammatory to a rather anti-inflammatory Th2-mediated cytokine milieu [58,60] which is of particular interest because an imbalance of Th1- and Th2-cells is considered relevant in MS pathogenesis [62].
Since established immunomodulatory drugs such as IFN-? or glatiramer acetate exert similar effects on the immune system, drug treatment and physical activity may complement each other in terms of modulating the immune system. The only short lasting effects of exercise on the immune cell level argue for regular and frequent training intervals.
The effect of exercise on cytokine production and response is less clear and often contradictory [44,60,62,64], which can in part be explained by different populations studied, different training protocols and/or different readout parameters and paradigms. For example, Heesen et al. found similar resting serum concentrations of IFN- ?, TNF- ? and IL-10 in trained and untrained MS patients [62], whereas White et al. reported reduced resting plasma concentrations of IL-4, IL-10, C-reactive protein (CRP) and IFN- ? and a tendency for decreased TNF- ? in MS patients upon eight weeks of PRE. Muscle contractions are thought to stimulate secretion of IL-6 [44,65]. Likewise, contradictory data have been published on the effect of exercise on immunoregulatory IL-6 in MS patients [44,64].
Given the neurodegenerative component of MS, the effect of physical activity, particularly of exercise on nerve growth factors is of particular importance. In rodents, exercise has been shown to stimulate the release of brain-derived neurotrophic factor (BDNF) [66], insulin-like growth factor 1 (IGF-1) [67-69] and vascular endothelial growth factor (VEGF) [70], all of which support cell proliferation, synaptic plasticity, neuroprotection, and neurogenesis in both physiological and neuroinflammatory conditions [67,71-74]. Also in humans exercise seems to modify the secretion of neuroactive proteins [14,67]. In both healthy participants and MS patients 30 min of moderate ergometry-based exercise increased the concentrations of BDNF and nerve growth factor (NGF) [59,75]. Increased hippocampal BDNF concentrations have been measured upon moderate exercise [67]. Since the hippocampus is crucially involved in learning and memory tasks and modulation of mood, these findings might connect exercise with slowing of cognitive impairment and stabilization of affect in MS patients [67]. An increased secretion of IGF-1 has so far been demonstrated in healthy people after exercise [76-78]. IGF-1 as an important factor in development supports cell survival, brain growth and CNS myelination. During later phases of life IGF-1 might play a role in neuroprotection and synaptic and cognitive plasticity [67]. Furthermore, exercise increased the activity of antioxidant enzymes, which might support the role of exercise in neuroprotection [67].
Exercise in MS Patients: Effects on Morphology and Imaging Findings
Repetitive activation of the motor programs strengthens the cortical engrams and causes neuroplastic and adaptive processes like improved motor unit activation and synchronization of firing rates. In contrast periods of inactivity are associated with opposite effects [35,49,79].
Although data on the effect of physical activity on brain structural parameters are sparse, some evidence indicates that physiotherapy and regular fitness training counteract the structural degeneration of brain tissue in patients with relapsing-remitting MS and possibly have a neuroprotective impact. Both grey and white matter atrophy occurs already in early stages of relapsing-remitting MS [80]. However, patients with a higher level of aerobic fitness were shown to have a comparatively larger local volume of grey matter in the right post-central gyrus and midline cortical structures including the frontal medial and the anterior cinguli gyrus and the precuneus somatosensory cortex than unfit patients. Furthermore higher fitness levels were associated with greater recruitment of cortical regions whereas lower fitness levels were associated with enhanced anterior cingulated cortex activity [81]. These data should however be treated with caution as they based on a small sample of 24 female MS patients with a wide range in disability (EDSS 0-6) and disease duration (1-18 years).
MS patients have been shown to have more brain areas, often bilaterally, activated when performing motor and cognitive tasks compared to healthy controls, possibly as an expression of neuroplasticity [82-92]. The degree of ipsilateral activation appears to correlate with the disease course and severity [85,88,93] and is considered to reflect cortical adaptive reorganization processes [82,85,86]. For example, in MS patients with primary progressive disease course movement-associated cortical activation involved “nonmotor” areas like the insula and several multimodal cortical regions in the temporal, parietal, and occipital lobes in addition to the “classic” areas of motor planning and execution regions (including the supplementary motor area and the cingulate motor area) [93]. Morgen et al. reported that thumb movements of untrained MS patients elicited a more prominent activation of the contralateral dorsal premotor cortex in fMRI than in healthy controls [85] which in contrast to healthy controls was not attenuated upon repetitive thumb movements.
In MS patients the corpus callosum is typically affected. Besides callosal lesions detected by standard MRI sequences, diffusion tensor imaging sequences show ultrastructural damage, reflected by a reduced fractional anisotropy and increased mean diffusivity [79,94-98]. Interestingly, in a small study comprising 11 MS patients and healthy controls, Ibrahim et al. described a significant increase of fractional anisotropy and mean diffusivity in the corpus callosum after a two months physiotherapy program of 2 h per week, suggesting that physiotherapy may influence the brain microstructure in MS [79]. In summary, some data suggest, that effects of exercise in MS patients may be reflected by morphological changes in the CNS which may be detectable by advanced imaging techniques. However, existing data are not yet sufficient to unequivocally prove an impact of exercise on brain structure in MS.
Personalized Exercise in MS Patients: General and Specific Recommendations
At the start of the 1990’s the German Federal Health Monitoring System’s general recommendation of performing a specific health-related training program at least three times a week was replaced by a more global perspective, namely the integration of everyday physical activities. In the situation of MS patients with an often reduced everyday activity, regular exercise is particularly important. Apart from improving muscle strength, exercise is intended to improve endurance, muscle tone and posture stability, the degree of flexibility, and endurance should involve both the agonists and antagonists [15,35]. A physical training program needs to be tailored to the individual needs and symptoms of a patient. Factors to be considered include the course and stage of disease, the degree of disability, age, concomitant diseases and sequelae. Importantly, it has to be ensured that the patient is not overstrained [14-16].
Compared to healthy people MS patients have a reduced aerobic capacity [14,26,38], decreased muscle strength, retarded rate of muscle tension development, reduced muscle endurance and impaired balance [14,15,36,99-101]. A relationship between gait speed and strength parameters has been postulated [102]. Petajan and White illustrated the level of muscular fitness and physical activity of MS patients in two “pyramids”: passive range of motion (ROM) forms the basis of the muscular fitness pyramid and can minimize the risk of contractures when practiced regularly [16]. The next step in the pyramid comprises active flexibility and resistance exercise against or without gravity to maintain muscle integrity, for example to enable the patient carrying out essential daily functions. A well-rounded program of muscle strengthening exercise represents the top of the muscular fitness pyramid [16]. ADLs form the basis of the physical activity pyramid, followed by built-in inefficiencies, active recreation, and structured aerobic training programs. Again, design, frequency, and intensity of training programs have to be tailored to the individual patient. Weight-supported exercises like ergometry and water exercise are particularly recommended for patients with motor deficit or balance disturbances [16].
No specific recommendations for exercise treatment exist that are universally valid. However, general therapeutic recommendations can be defined. Since exercise programs have not sufficiently been investigated in more severely disabled patients, these recommendations are restricted to MS patients with a maximum EDSS score of 7 [14,15,34,38]. Any new exercise program should be initialized by a physiotherapist or exercise physiologist familiar with the disease [14]. A brief history including impairments in particular within daily activities should be elicited [16]. Regardless of the type of exercise, training programs should be uncomplicated and comprehensible to the patients. If necessary, it might be advisable to explain training programs in an illustrated or written form [15]. Patients should be supervised until they can perform the program adequately and independently [14-16,26]. Exercise programs should specifically target weaker muscles, and should preferably encompass multisegmental complex movements [15,35]. The intensity should be increased only slowly, and not to the point of pain [15]. Special care should be paid to peripheral nerves; particularly overstretching should be avoided [15]. Training sessions are recommended to start at a low level, include a light warm-up, progress according to the patients’ clinical state and specific problems, and finally reach light to moderate intensity [14-16,26]. 10-15 min of daily stretching to maintain and improve flexibility of muscles and tendons [15] and recovery time between training sessions of 24-48 h are recommended [15]. Immobilized patients or those with severe clinical symptoms should be individually assisted. Some authors advise that cardiopulmonary function and VO2-max should be assessed prior to treatment start since MS patients may have reduced heart rate responses in graded exercise testing, possibly as an expression of cardiovascular dysautonomia [15,16], although this probably can hardly be implemented in the daily routine. Regarding endurance training and according to the American College of Sports Medicine, White and Dressendorfer recommend using the actual heart rate response to graded exercise testing for finding the ideal target heart range for training [15]. No symptoms should appear and “moderate intensities” ought to be strived, for example by means of the Borg scale of perceived exertion, which ranges from 6 to 20 (6 means “no exertion at all”, 20 means “maximal exertion”). For moderate intensities ranges from 11 to 14 are aspired [15,103]. Depending on the symptoms and the training program, exercises should be performed at home, individually, with a training partner, or with a training group, and may include training equipment such as elastic bands, additional weights and pulley systems. Due to its social support a training group seems to be favorable in terms compliance and motivation [16,28]. To achieve similar effects in home-based training programs, patients should be closely supervised, for example by visits or telephone calls [16,28]. Most importantly, the training sessions have to be performed regularly [14-16,26].
Some special recommendations regarding exercise training for MS patients have been published. However, it has to be emphasized that these recommendations mostly represent personal experiences made by the authors and are not always supported by high standard clinical trials. Dalgas et al., for example, recommended endurance training of approximately 10-40 min duration, with an initial training intensity of 50-70% of VO2-max corresponding to 60-80% of maximum heart rate [14]. According to Dalgas et al., resistance training is recommended to initially comprise 8-15 repetitions which can then be increased over several months. The training should start with 1-3 sets, later 3-4 sets with a 2-4 min break between sets and should be performed two or three times per week. For heat-sensitive patients and those who regularly develop Uhthoff’s phenomenon exercise training in the morning or in water at temperatures of 27-28�C could be preferable since body temperature is physiologically lower early in the day and heat generated by physical activity is quickly dissipated in water [15,16]. Alternatively, cooling before exercise and/or during physical activity for example by cold packs may help to prevent Uhthoff’s phenomenon [15,16,55]. Also, resistance instead of endurance training could be preferable for heat-sensitive patients [14].
Multiple sclerosis, or MS, is a chronic, generally progressive disease caused when the immune system damages the sheaths of nerve cells in the brain and spinal cord. For many years, doctors recommended patients with MS to avoid engaging in any form of physical activity or exercise, however, recent research studies have found that staying active can be beneficial for MS symptoms. Common symptoms associated with multiple sclerosis include numbness, impairment of speech and of muscular coordination, blurred vision, and severe fatigue. Dr. Alex Jimenez D.C., C.C.S.T. Insight
Physical Therapy Approaches to Prevent or Alleviate Individual Target Symptoms and Signs in MS
Fatigue
Fatigue, defined as an extreme physical and mental tiredness inadequate to the preceding demand, is a frequent, often very debilitating symptom in MS, which is generally difficult to treat [8-10,15,35,104-106]. Approximately 75-90% of all MS patients experience fatigue during disease progression [8,10,16] and some MS patients end up in a vicious circle: out of a wish to reduce fatigue they decrease physical activity which over time reduces endurance, muscle strength, and quality of life and may enhance fatigue, which then thus in turn further limits physical activity and social life [9,42,49]. Apart from cooling, moderate exercise, particularly aerobic training, seems to have a positive effect on fatigue [30,35,45]. Because fatigue often increases over the day, training sessions should be performed in the morning and must not overexert the patient [104]. Special supports like participation in a training group or attending psychological support to increase motivation for continuation of training over time could be advantageous in patients suffering from fatigue [16]. Energy saving strategies are also applied, in which the patient learns to prioritize and to perform everyday tasks with a minimum of exertion [4,16,27]. Although a beneficial effect of moderate exercise on fatigue has been described by some authors [14,28,35,41], effects are usually insufficient to achieve significant improvements in current fatigue scales [17,35,45,47,50]. Other studies completely failed to detect any improvements [33]. One explanation for contradicting results can be found in the use of different fatigue scales, which focus on physical symptoms, or in attendant sleep disturbances such as insomnia, sleep-related breathing disorders, restless legs syndrome, periodic limb movement disorder [104-106]. In conclusion, there is some however not unequivocal evidence for low to moderate beneficial effects of moderate exercise on fatigue.
Spasticity
With a lifetime prevalence of about 90% spasticity is frequent in MS and has a potential to significantly reduced quality of life [104]. It leads to limitations in the range and normal pursuit of movements, results in malpositioning of the joints, and is often accompanied by pain [24]. Controlled studies on exercise and physiotherapy for MS-related spasticity are rare; however some evidence for improvements has been reported [104].
Physical therapy measures include active and passive exercise (e.g. targeted positioning of the patient, passive exercise using motorized cycles, active treadmill exercise) which can be assisted by a training partner or training equipment such as elastic bands. Physiotherapeutic techniques according to Bobath or Vojta and proprioceptive neuromuscular facilitation (PNF) are among the treatments applied. None of these measures has been proven to be superior [104,107]. It is most important to carry them out regularly and with a sufficient intensity [4,104]. Light stretching of the affected muscle groups with duration of approximately 20-60 s should be performed prior to and after exercise [15].
Pareses
Pareses lead to various physical disabilities, such as difficulty in walking and fine-motor dysfunction. A relationship between gait speed and muscle strength in MS patients has been shown [14]. As no drug treatment for pareses exists and antispastic drugs such as baclofen may also lead to a worsening of existing pareses, physical and occupational therapy techniques are the sole treatment option. Because of reduced impact of gravity aquatic training allows patients with even severe pareses of the lower extremities to perform standing and moving exercises [15,16]. A standing frame can help patients who are unable to stand, to train torso, limb, and respiratory muscles and protects against cardiovascular dysregulation. For immobilized patients, passive range of motion exercises proximal to the paralyzed region is recommended [15,16]. Various studies have shown a significant improvement of muscle strength due to exercise [33,35,40,101]. Furthermore, some authors reported beneficial effects in walking speed, stepping endurance, stair climbing, and timed up and go test [35,40,49]. In summary, evidence suggests that exercise is beneficial in the treatment of MS-related pareses, however again, only few, partially inconsistent data are available. Moreover, the effects of exercise have been studied almost exclusively in MS patients with mild or moderate impairment.
Coordination and Balance Dysfunction
Abnormalities in balance control are frequent symptoms in MS patients, which restrict patients in their daily living activities and increased risk of falls [5]. Balance skills like standing and walking, as well as the patients’ perception of their own balance are important to assess [5]. The sitting position of cycling training is advantageous for unsteady patients [15,16]. Only a few studies investigated the influence of exercise programs on balance and coordination in MS and very few have chosen these variables as the primary outcome parameter. Catteneo et al., for example, investigated the effect of balance training in 44 MS patients in a randomized controlled trial [5]. Two treatment groups received particular balance rehabilitation for three weeks, a third (control) group participated an unspecific training program. In both treatment groups, a reduction of the number of falls and an improvement in clinical tests of static balance (Berg Balance Scale) and dynamic balance (Dynamic Gait Index) could be detected. However, in self-assessment scales patients did not report significant improvements [5]. Another controlled study did not support a beneficial effect of exercise training on static balance [34].
Cognitive and Mood Disturbances
Depending on the disease course and stage 45-70% of MS patients are affected by cognitive impairments like reduced information processing speed, attentional deficits, and episodic memory deficits [12,13,24,104,108] and 60-70% experience mood disturbances [13,109,110]. Some evidence for a positive correlation between aerobic exercise and cognition and brain function in healthy people has been described [81]. In MS patients, beneficial effects of regular physical activity and exercise on mood [18,32,35,48] and quality of life [14,15,28,34] have been repeatedly reported. Valid data on the effect on cognitive function are hardly available.
Conclusion and Outlook
Several lines of evidence suggest that MS patients benefit from regular physical activity and exercise high-quality clinical, imaging and physiological parameters. However, the quality of so far realized clinical trials on exercise training in MS do not always satisfy the requirements of a high standard study. Moreover, because of different treatment paradigms and endpoints, data are often hardly comparable. Thus, many questions remain still unanswered. In consequence, there is a great need for standardized high quality and well described studies that address both short and long-term effects of exercise on clinical and paraclinical parameters in MS patients with different disease courses and different grades of disability.
Conflicts of Interests
The authors declare that they have no competing interests.
Acknowledgements
This work was supported by the DFG (Exc 257).
For the estimated 400,000 people in the United States living with multiple sclerosis, participating in physical activities and exercises can have tremendous health benefits. Although healthcare professionals advocated the limitation of exercise for patients with MS, many research studies like the one above have demonstrated that exercise can help improve multiple sclerosis symptoms, enhancing a patient’s quality of life. For people with MS, their life doesn’t have to come to a standstill. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Back pain�is one of the most prevalent causes of disability and missed days at work worldwide. Back pain attributes to the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments, and muscles, among other soft tissues. Injuries and/or aggravated conditions, such as�herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief. �
Oxidative stress is a major contributor in the development of a variety of health issues, including cancer, heart disease, diabetes, accelerated aging and neurodegeneration. Antioxidant rich foods, herbs and supplements can be utilized to protect the human body from high levels of oxidative stress. Recent research studies have demonstrated that the Nrf2 gene pathway can help amplify the effects of antioxidants. The benefits of Nrf2 are described below.
Protects the Body Against Toxins
NRF2 is an intrinsic substance which can protect the cells from harmful, internal and external compounds. NRF2 may help enrich the human body’s reaction to drugs/medications and toxins, improving the production of�proteins that help eliminate compounds from the cell, known as multidrug resistance-associated proteins, or MRPs.�By way of instance, NRF2 is triggered upon cigarette smoke inhalation to allow the lungs to detox.
Additionally, it is essential for the lungs to protect themselves against allergens, viral diseases, bacterial endotoxins, hyperoxia, and various environmental pollutants. The constant trigger of Nrf2 however, can decrease the levels of a substance known as glutathione throughout the human body. NRF2 may also protect the liver from toxicity and it can protect the liver from arsenic hepatotoxicity. Moreover, NRF2 protects the liver and brain from alcohol consumption. By way of instance, Nrf2 can protect�against acetaminophen toxicity.
Fights Inflammation And Oxidative Stress
NRF2 activation can help battle against inflammation by diminishing inflammatory cytokines, such as those present in psoriasis. NRF2 may also decrease inflammation associated with a variety of health issues like arthritis and fibrosis of the liver, kidney, and lungs. NRF2 may also help control allergies by lowering Th1/Th17 cytokines and raising TH2 cytokines. This can be beneficial for ailments like asthma.
NRF2 additionally protects against cellular damage from blue light�and from UVA/UVB� found in sunlight. Nrf2 deficiencies can make it a whole lot easier to get sunburnt. One rationale behind this is because NRF2 is capable of regulating collagen in response to UV radiation. Advanced Glycation End-Products, or AGEs, contribute to the development of many health issues, including diabetes and neurodegenerative diseases. NRF2 can decrease the oxidative stress of AGEs within the body. NRF2 may also protect the human body from higher levels of heat-based stress.
Enhances Mitochondria And Exercise Performance
NRF2 is a mitochondrial booster. NRF2 activation contributes to a rise in ATP energy for mitochondria, in addition to enhanced use of oxygen, or citrate, and fat. With no NRF2, mitochondria would just have the ability to function with sugar, or glucose, rather than fat. NRF2 is also essential for mitochondria to develop through a process known as biogenesis. NRF2 activation is vital in order to�take advantage of� the benefits of exercise.
Because of�Nrf2’s activity, exercise raises mitochondrial function, where this result may be amplified with CoQ10, Cordyceps, and Caloric Restriction. Moderate exercise or acute exercise induces mitochondrial biogenesis and an elevated synthesis of superoxide dismutase, or SOD, and heme-oxygenase-1, or HO-1, through NRF2 activation. Alpha-Lipoic Acid,�or ALA, and Dan Shen can boost NRF2 mediated mitochondrial biogenesis. Furthermore,�NRF2 can also improve exercise tolerance where NRF2 deletion makes exercise harmful.
Protects Against Hypoxia
NRF2 also helps protect the human body from cellular oxygen loss/depletion, a health issue called hypoxia. Individuals with CIRS have reduced levels of oxygen since their NRF2 is obstructed, resulting in reduced levels of both VEGF, HIF1, and HO-1. Ordinarily, in healthy individuals with hypoxia, miR-101, which is required for the creation of stem cells, are overexpressed and enhance amounts of NRF2/HO-1 and VEGF/eNOS, therefore preventing brain damage, but that does not appear to occur in CIRS.
Hypoxia, characterized by low HIF1, in CIRS can also result in a leaky blood brain barrier due to an NRF2 imbalance. Salidroside, located in the Rhodiola, functions on NRF2 activation and assists with hypoxia by increasing levels of VEGF and HIF1 within the human body. NRF2 can also ultimately protect against lactate buildup in the heart. NRF2 activation may also stop hypoxia-induced Altitude Motion Sickness, or AMS.
Slows Down Aging
Several compounds which may be fatal in massive quantities may increase longevity in rather tiny quantities due to xenohormesis through NRF2, PPAR-gamma, and FOXO. A�very small quantity of toxins raises the cell’s ability to become better equipped for the next time it’s challenged with a toxin, however, this is not an endorsement to consume poisonous�chemicals.
A good illustration of this process is with caloric restriction. NRF2 can improve the lifespan of cells by raising their levels of mitochondria and antioxidants as well as lowering the cells’ capability to die. NRF2 declines with aging because NRF2 prevents stem cells from dying and assists them to�regenerate. NRF2 plays a part in enhancing wound healing.
Boosts the Vascular System
Done correctly with the production of sulforaphane, NRF2 activation may protect against heart diseases like high blood pressure, or hypertension, and hardening of the arteries, or atherosclerosis. NRF2 can enhance Acetylcholine’s, or ACh, relaxing activity on the vascular system whilst reducing cholesterol-induced stress. Nrf2 activation may strengthen the heart, however, over-activated Nrf2 can raise the probability of cardiovascular disease.
Statins may prevent or lead to cardiovascular disease. NRF2 also plays a major part in balancing iron and calcium which may shield the human body from having elevated levels of iron. By way of instance, Sirtuin 2, or SIRT2, can regulate iron homeostasis in cells by activation of NRF2 which is believed to be required for healthy levels of iron. NRF2 can also help with Sickle Cell Disease, or SCD. NRF2 dysfunction might be a reason behind endotoxemia like with dysbiosis or lectins induced hypertension. Nrf2 may also protect the human body against amphetamine induced damage to the vascular system.
Fights Neuroinflammation
NRF2 can shield against and assist with inflammation of the brain, commonly referred to as neuroinflammation. Furthermore, NRF2 can help with an Assortment of Central Nervous System, or CNS, disorders, including:
Alzheimer’s Disease (AD) – reduces amyloid beta stress on mitochondria
Amyotrophic Lateral Sclerosis (ALS)
Huntington’s Disease (HD)
Multiple Sclerosis (MS)
Nerve Regeneration
Parkinson’s disease (PD) – protects dopamine
Spinal Cord Injury (SCI)
Stroke (ischemic and hemorrhagic) – aids hypoxia
Traumatic Brain Injury
NRF2 has revealed a decrease of neuroinflammation in teens with Autism Spectrum Disorders�or ASD. Idebenone pairs properly with NRF2 activators contrary to neuroinflammation. NRF2 may also improve the Blood Brain Barrier,�or BBB. By way of instance, NRF2 activation with carnosic acid obtained from rosemary and sage can cross the BBB and cause neurogenesis. NRF2 has also been demonstrated to raise�Brain Derived Neurotrophic Factor, or BDNF.
NRF2 also modulates some nutritional supplements capacity to cause Nerve Growth Factor, or NGF as it� can also aid with brain fog and glutamate-induced issues by modulating N-Methyl-D-Aspartate,�or NMDA receptors. It may also lower the oxidative stress from quinolinic acid, referred to as QUIN. NRF2 activation can protect against seizures and large doses can decrease the brink of a seizure. At regular doses of stimulation, NRF2 can enhance cognitive abilities following a seizure by lowering extracellular glutamate in the brain and by it’s ability to draw cysteine from glutamate and glutathione.
Relieves Depression
In depression, it’s normal to notice inflammation in the brain, especially from the prefrontal cortex and hippocampus, as well as decreased BDNF. In some versions of depression, NRF2 can improve depressive symptoms by lowering inflammation within the brain and increasing BDNF levels. Agmatine’s capability to decrease depression by raising noradrenaline, dopamine, serotonin, and BDNF in the hippocampus depends upon NRF2 activation.
Contains Anti-Cancer Properties
NRF2 is equally a tumor suppressor as it is a tumor promoter if not managed accordingly. NRF2 can protect against cancer caused by free radicals and oxidative stress, however, NRF2 overexpression can be found in cancer cells as well. Intense activation of NRF2 can assist with a variety of cancers. By way of instance, the supplement Protandim can reduce skin cancer by NRF2 activation.
Relieves Pain
Gulf War Illness, or GWI, a notable illness affecting Gulf War Veterans, is a collection of unexplained, chronic symptoms which may include tiredness, headaches, joint pain, indigestion, insomnia, dizziness, respiratory ailments, and memory issues. NRF2 can improve symptoms of GWI by diminishing hippocampal and general inflammation, in addition to decreasing pain. NRF2 can additionally assist with pain from bodily nerve injury and improve nerve damage from diabetic neuropathy.
Improves Diabetes
High glucose levels, best referred to as hyperglycemia, causes oxidative damage to the cells due to the disruption of mitochondrial function. NRF2 activation may shield the human body against hyperglycemia’s harm to the cell, thereby preventing cell death. NRF2 activation can additionally protect, restore, and enhance pancreatic beta-cell function, while reducing insulin resistance.
Protects Vision And Hearing
NRF2 can protect against harm to the eye from diabetic retinopathy. It might also avoid the formation of cataracts and protect photoreceptors contrary to light-induced death. NRF2 additionally shield the ear, or cochlea, from stress and hearing loss.
Might Help Obesity
NRF2 may help with obesity primarily due to its capacity to regulate variables that operate on fat accumulation in the human body. NRF2 activation with sulforaphane can raise inhibit of Fatty Acid Synthesis, or FAS, and Uncoupling Proteins, or UCP, resulting in less fat accumulation and more brown fat, characterized as fat which includes more mitochondria.
Protects The Gut
NRF2 helps protect the gut by safeguarding the intestine microbiome homeostasis. By way of instance, lactobacillus probiotics will trigger NRF2 to guard the gut from oxidative stress. NRF2 can also help prevent Ulcerative Colitis, or UC.
Protects Sex Organs
NRF2 can shield the testicles and keep sperm count from harm in people with diabetes. It can also assist with Erectile Dysfunction, or ED. Some libido boosting supplements like Mucuna, Tribulus, and Ashwaganda�may enhance�sexual function via NRF2 activation. Other factors that boost NRF2, such as sunlight or broccoli sprouts, can also help improve libido.
Regulates Bones And Muscles
Oxidative stress may result in bone density and strength reduction, which is normal in osteoporosis. NRF2 activation could have the ability to improve antioxidants in bones and protect against bone aging. NRF2 can also prevent muscle loss and enhance Duchenne Muscular Dystrophy, or DMD.
Contains Anti-Viral Properties
Last but not least, NRF2 activation can ultimately help defend the human body against several viruses. In patients with the dengue virus, symptoms were not as intense in individuals who had greater levels of NRF2 compared to individuals who had less degrees of NRF2. NRF2 can also help people who have Human Immunodeficiency-1 Virus,�or HIV. NRF2 can protect against the oxidative stress from Adeno-Associated Virus,�or AAV, and H. Pylori. Finally, Lindera Root may suppress Hepatitis C virus with NRF2 activation.
Nrf2, or NF-E2-related factor 2, is a transcription factor found in humans which regulates the expression of a specific set of antioxidant and detoxifying genes. This signaling pathway is activated due to oxidative stress as it enhances numerous antioxidant and phase II liver detoxification enzymes to restore homeostasis in the human body. Humans are adapted to function throughout a state of homeostasis or balance. When the body is confronted with oxidative stress, Nrf2 activates to regulate oxidation and control the stress it causes. Nrf2 is essential to prevent health issues associated with oxidative stress. Dr. Alex Jimenez D.C., C.C.S.T. Insight
Sulforaphane and Its Effects on Cancer, Mortality, Aging, Brain and Behavior, Heart Disease & More
Isothiocyanates are some of the most important plant compounds you can get in your diet. In this video I make the most comprehensive case for them that has ever been made. Short attention span? Skip to your favorite topic by clicking one of the time points below. Full timeline below.
Key sections:
00:01:14 – Cancer and mortality
00:19:04 – Aging
00:26:30 – Brain and behavior
00:38:06 – Final recap
00:40:27 – Dose
Full timeline:
00:00:34 – Introduction of sulforaphane, a major focus of the video.
00:01:14 – Cruciferous vegetable consumption and reductions in all-cause mortality.
00:02:12 – Prostate cancer risk.
00:02:23 – Bladder cancer risk.
00:02:34 – Lung cancer in smokers risk.
00:02:48 – Breast cancer risk.
00:03:13 – Hypothetical: what if you already have cancer? (interventional)
00:03:35 – Plausible mechanism driving the cancer and mortality associative data.
00:04:38 – Sulforaphane and cancer.
00:05:32 – Animal evidence showing strong effect of broccoli sprout extract on bladder tumor development in rats.
00:06:06 – Effect of direct supplementation of sulforaphane in prostate cancer patients.
00:07:09 – Bioaccumulation of isothiocyanate metabolites in actual breast tissue.
00:08:32 – Inhibition of breast cancer stem cells.
00:08:53 – History lesson: brassicas were established as having health properties even in ancient Rome.
00:09:16 – Sulforaphane’s ability to enhance carcinogen excretion (benzene, acrolein).
00:09:51 – NRF2 as a genetic switch via antioxidant response elements.
00:10:10 – How NRF2 activation enhances carcinogen excretion via glutathione-S-conjugates.
00:10:34 – Brussels sprouts increase glutathione-S-transferase and reduce DNA damage.
00:11:20 – Broccoli sprout drink increases benzene excretion by 61%.
00:13:31 – Broccoli sprout homogenate increases antioxidant enzymes in the upper airway.
00:15:45 – Cruciferous vegetable consumption and heart disease mortality.
00:16:55 – Broccoli sprout powder improves blood lipids and overall heart disease risk in type 2 diabetics.
00:19:04 – Beginning of aging section.
00:19:21 – Sulforaphane-enriched diet enhances lifespan of beetles from 15 to 30% (in certain conditions).
00:20:34 – Importance of low inflammation for longevity.
00:22:05 – Cruciferous vegetables and broccoli sprout powder seem to reduce a wide variety of inflammatory markers in humans.
00:36:32 – Sulforaphane improves learning in model of type II diabetes in mice.
00:37:19 – Sulforaphane and duchenne muscular dystrophy.
00:37:44 – Myostatin inhibition in muscle satellite cells (in vitro).
00:38:06 – Late-video recap: mortality and cancer, DNA damage, oxidative stress and inflammation, benzene excretion, cardiovascular disease, type II diabetes, effects on the brain (depression, autism, schizophrenia, neurodegeneration), NRF2 pathway.
00:40:27 – Thoughts on figuring out a dose of broccoli sprouts or sulforaphane.
00:41:01 – Anecdotes on sprouting at home.
00:43:14 – On cooking temperatures and sulforaphane activity.
00:43:45 – Gut bacteria conversion of sulforaphane from glucoraphanin.
00:44:24 – Supplements work better when combined with active myrosinase from vegetables.
00:44:56 – Cooking techniques and cruciferous vegetables.
00:46:06 – Isothiocyanates as goitrogens.
When the human body is confronted with harmful internal and external factors like toxins, the cells must rapidly trigger their antioxidant abilities to counteract oxidative stress. Because increased levels of oxidative stress have been determined to cause a variety of health issues, it’s important to use Nrf2 activation to take advantage of its benefits. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Curated by Dr. Alex Jimenez
Additional Topic Discussion:�Acute Back Pain
Back pain�is one of the most prevalent causes of disability and missed days at work worldwide. Back pain attributes to the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments, and muscles, among other soft tissues. Because of this, injuries and/or aggravated conditions, such as�herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief. �
Sulforaphane is a phytochemical, a substance within the isothiocyanate group of organosulfur compounds, found in cruciferous vegetables, such as broccoli, cabbage, cauliflower, and Brussels sprouts. It can also be found in bok choy, kale, collards, mustard greens and watercress. Research studies have shown that sulforaphane can help prevent various types of cancer by activating the production of Nrf2, or nuclear factor erythroid 2-related factor, a transcription factor which regulates�protective antioxidant mechanisms that control the cell’s response to oxidants. The purpose of the following article is to describe the function of sulforaphane.
Abstract
The KEAP1-Nrf2-ARE antioxidant system is a principal means by which cells respond to oxidative and xenobiotic stresses. Sulforaphane (SFN), an electrophilic isothiocyanate derived from cruciferous vegetables, activates the KEAP1-Nrf2-ARE pathway and has become a molecule-of-interest in the treatment of diseases in which chronic oxidative stress plays a major etiological role. We demonstrate here that the mitochondria of cultured, human retinal pigment epithelial (RPE-1) cells treated with SFN undergo hyperfusion that is independent of both Nrf2 and its cytoplasmic inhibitor KEAP1. Mitochondrial fusion has been reported to be cytoprotective by inhibiting pore formation in mitochondria during apoptosis, and consistent with this, we show Nrf2-independent, cytoprotection of SFN-treated cells exposed to the apoptosis-inducer, staurosporine. Mechanistically, SFN mitigates the recruitment and/or retention of the soluble fission factor Drp1 to mitochondria and to peroxisomes but does not affect overall Drp1 abundance. These data demonstrate that the beneficial properties of SFN extend beyond the activation of the KEAP1-Nrf2-ARE system and warrant further interrogation given the current use of this agent in multiple clinical trials.
Sulforaphane is an Nrf2-Independent Inhibitor of Mitochondrial Fission
Sulforaphane (SFN) is an isothiocyanate compound derived in the diet most commonly from cruciferous vegetables [56]. It is generated in plants as a xenobiotic response to predation via vesicular release of the hydrolytic enzyme myrosinase from damaged cells; this enzyme converts glucosinolates to isothiocyantes [42]. Over the last two decades, SFN has been extensively characterized for its reported anticancer, antioxidant, and antimicrobial properties [57]. Much of this efficacy has been attributed to the capacity of SFN to modulate the KEAP1-Nrf2-antioxidant response element (ARE) signaling pathway, although additional activities of the compound have been identified, including the inhibition of histone deacetylase activity and cell cycle progression [29]. Nrf2 is the master antioxidant transcription factor and under conditions of homeostasis, its stability is suppressed through the action of the cytoplasmic Cullin3KEAP1 ubiquitin ligase complex [20]. Specifically, Nrf2 is recruited to the Cullin3KEAP1 ligase by binding to the dimeric substrate adaptor KEAP1 and is subsequently modified with polyUb chains that target the transcription factor for proteasome-mediated degradation. This constitutive turnover limits the half-life of Nrf2 in unstressed cells to ~15 min [30], [33], [46], [55]. In response to numerous types of stress, most notably oxidative stress, KEAP1, a cysteine-rich protein, acts as a redox sensor, and oxidative modification of critical cysteines, particularly C151, of KEAP1 dissociates Nrf2-KEAP1 from CUL3 thereby preventing Nrf2 degradation [8], [20], [55]. Notably, SFN, and possibly other Nrf2 activators, mimic oxidative stress by modifying C151 of KEAP1 e.g. [21]. Stabilization of Nrf2 allows for its translocation to the nucleus where it induces the expression of a battery of Phase II antioxidant and detoxification genes. Nrf2 binds to the antioxidant response promoter elements (ARE) of its cognate target genes through heterodimerization with small Maf proteins [19]. This system presents a dynamic and sensitive response to indirect antioxidants like SFN, free radicals generated by the mitochondria [16], or other physiologic sources of oxidative stress [41].
Mitochondria are dynamic, subcellular organelles that regulate a host of cellular functions ranging from ATP production and intracellular calcium buffering to redox regulation and apoptosis [13], [49]. Mitochondria also represent the principal source of reactive oxygen species (ROS) within the cell. Proper regulation of mitochondrial function is therefore necessary for optimizing ATP production to meet cellular needs while simultaneously minimizing the potentially harmful effects of excessive free radical production. A critical requirement for fine modulation of mitochondrial function is the capacity for mitochondria to function both independently as biochemical machines and as part of a vast, responsive network.
Mitochondrial network morphology and function are determined by a regulated balance between fission and fusion. Mitochondrial fission is required for daughter cell inheritance of mitochondria during cell division [28] as well as for the selective, autophagic degradation of depolarized or damaged mitochondria, termed mitophagy [1]. Conversely, fusion is required for complementation of mitochondrial genomes and sharing of electron transport chain components between neighboring mitochondria [54]. At the molecular level, mitochondrial fission and fusion are regulated by large, dynamin-like GTPases. Three enzymes primarily regulate fusion: Mitofusins 1 and 2 (Mfn1/2) are two-pass outer membrane proteins that mediate outer membrane fusion via heterotypic interactions between adjacent mitochondria [15], [25], [37], while OPA1 is an inner membrane protein that simultaneously ensures matrix connectivity by regulating the melding of inner membranes [5]. The GTPase activity of all three proteins is required for robust fusion [5], [18], and OPA1 is further regulated by complex proteolysis within the mitochondrial inner membrane by the proteases OMA1 [14], PARL [6], and YME1L [45]. Importantly, intact mitochondrial membrane potential is required for efficient fusion in order to suppress integration of damaged and healthy mitochondria [26].
Mitochondrial fission is primarily catalyzed by a cytosolic protein called Dynamin-related protein 1 (Drp1/DNM1L). Drp1 is recruited from the cytosol to prospective sites of fission on the mitochondrial outer membrane [43]. The major receptors for Drp1 on the outer membrane are mitochondrial fission factor (Mff) [32] and, to a lesser extent, Fission 1 (Fis1) [51]. Additionally, a decoy receptor, MIEF1/MiD51, was discovered that acts to further limit the activity of Drp1 protein at potential fission sites [58]. Once docked at the mitochondrial outer membrane, Drp1 oligomerizes into spiral-like structures around the body of the mitochondrion and then utilizes the energy derived from GTP hydrolysis to mediate the physical scission of the mitochondrial outer and inner membranes [17]. Endoplasmic reticulum-derived tubules act as an initial constrictor of mitochondria prior to Drp1 oligomerization, underscoring the revelation that non-constricted mitochondria are wider than the permissive circumference of a completed Drp1 spiral [12]. Actin dynamics are also important for the ER-mitochondria interactions that precede mitochondrial fission [24]. In addition to its role in mitochondrial fission, Drp1 catalyzes the fission of peroxisomes [40].
Drp1 is very similar to the well-characterized dynamin protein in that both proteins contain an N-terminal GTPase domain, a Middle domain that is critical for self-oligomerization, and a C-terminal GTPase effector domain [31]. Drp1 achieves selectivity for mitochondrial membranes through a combination of interactions with its receptor proteins Mff and Fis1 and also through its affinity for the mitochondria-specific phospholipid cardiolipin via the unique B-insert domain of Drp1 [2]. Drp1 typically exists as a homotetramer in the cytoplasm, and higher order assembly at mitochondrial fission sites is mediated by the Middle domain of Drp1 [3].
Given the implicit link between mitochondrial function and the KEAP1-Nrf2-ARE pathway, we investigated the effects of Nrf2 activation on mitochondrial structure and function. We demonstrate here that SFN induces mitochondrial hyperfusion that, unexpectedly, is independent of both Nrf2 and KEAP1. This effect of SFN is through an inhibition of Drp1 function. We further demonstrate that SFN confers resistance to apoptosis that is Nrf2-independent and mimics that observed in cells depleted of Drp1. These data collectively indicate that in addition to stabilizing and activating Nrf2, SFN modulates mitochondrial dynamics and preserves cellular fitness and survival.
Results
Sulforaphane Induces Nrf2/KEAP1-Independent Hyperfusion of Mitochondria
In the course of studying the effects of Nrf2 activation on mitochondrial network dynamics, we discovered that treatment of immortalized, human retinal pigment epithelial (RPE-1) cells with sulforaphane (SFN), a potent activator of Nrf2 signaling, induced a robust fusion of the mitochondrial network when compared with vehicle-treated control cells (Fig. 1A and B). The morphology of the mitochondria in these cells greatly resembled that of the mitochondria in cells depleted by siRNA of endogenous Drp1, the principal mitochondrial fission factor (Fig. 1A). This result raised the intriguing idea that mitochondrial fission and fusion status responds directly to Nrf2 levels in the cell. However, stimulation of cells with other Nrf2 stabilizers and activators such as the proteasome inhibitor MG132, the pro-oxidant tBHQ, or knockdown of the Nrf2 inhibitor KEAP1 did not induce mitochondrial fusion (Fig. 1A and B). Stabilization of Nrf2 by these manipulations was confirmed by western blotting for endogenous Nrf2 (Fig. 1C). Furthermore, expression of Nrf2 was dispensable for SFN-induced mitochondrial fusion, as knockdown of endogenous Nrf2 with siRNA failed to counter this phenotype (Fig. 1D�F). Because SFN stimulates the KEAP1-Nrf2-ARE pathway by covalently modifying cysteine residues of KEAP1 [21], we knocked down KEAP1 to address whether SFN-induced mitochondrial hyperfusion is stimulated through a KEAP1-dependent, but Nrf2 independent pathway. However, depletion of KEAP1 also failed to abrogate SFN-induced mitochondrial fusion (Fig. 1G�I). In fact, SFN reversed the pro-fission morphology induced by depletion of KEAP1 (Fig. 1G, panel b versus panel d). These results indicate that SFN treatment causes mitochondrial fusion independent of the canonical KEAP1-Nrf2-ARE pathway and led us to interrogate whether SFN directly affects components of the mitochondrial fission or fusion machinery.
Figure 1 SFN induces Nrf2/KEAP1-independent mitochondrial fusion. (A) RPE-1 cells were transfected with the indicated siRNAs and 3 days later treated with DMSO or the Nrf2 activators SFN (50 ?M), MG132 (10 ?M), or tBHQ (100 ?M) for 4 h. Mitochondria (red) are labeled with an anti-Tom20 antibody, and nuclei (blue) are counterstained with DAPI. (B) Graph showing quantification of mitochondrial morphology scoring from (A). >50 cells per condition were evaluated in a blinded fashion. (C) Representative western blots from (A). (D) RPE-1 cells were transfected with 10 nM siRNA and 3 days later treated with SFN for 4 h prior to being fixed and stained as in (A). (E) Graph showing quantification of mitochondrial phenotype scoring from (D). >100 cells per condition were evaluated in a blinded fashion. (F) Representative western blots from (D). (G) Cells were transfected and treated as in (D) with siCON or siKEAP1. (H) Cells from (G) were scored as in (B) and (E) on the basis of mitochondrial morphology. (I) Representative western blots from (G). Data in (B), (E), and (H) were compiled from 3 independent experiments each and statistical significance was determined by two-tailed Student’s t-test. Error bars reflect +/- S.D. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).
Sulforaphane Impairs the Mitochondrial Association of Drp1
Based on the finding that SFN-treatment induces mitochondrial hyperfusion, we reasoned that this phenotype was either a consequence of excessive fusion activity or an inhibition of fission activity. To discriminate between these two possibilities, we compared the morphology of peroxisomes in the presence and absence of SFN. Peroxisomes are similar to mitochondria in that they are dynamic organelles the shape and length of which are constantly in flux [44]. Peroxisomes contain both Fis1 and Mff in their outer membrane and, as a consequence, are targets for Drp1-mediated fission [22], [23]. However, peroxisomes do not utilize the fusion machinery of the mitochondrial network and consequently, do not undergo fusion [39]. Rather, peroxisomal fission is opposed by the lengthening of existing peroxisomes via de novo addition of membranes and proteins [44]. Because peroxisomes lack Mfn1/2 and OPA1, we reasoned that if SFN activates the fusion machinery rather than inhibiting the fission machinery, peroxisome length would not be affected. In vehicle-treated cells, peroxisomes are maintained as short, round, punctiform organelles (Fig. 2, panels b and d). However, SFN treatment increased peroxisome length by ~2-fold as compared to control cells (Fig. 2, panels f and h). Furthermore, many of the peroxisomes were pinched near the center, indicating a potential scission defect (Fig. 2, panel h, arrowheads). Likewise, peroxisomes in cells transfected with Drp1 siRNA were abnormally long (Fig. 2, panels j and l), confirming that Drp1 is required for peroxisomal fission and suggesting that SFN-treatment causes mitochondrial and peroxisomal phenotypes by disrupting the fission machinery.
Figure 2 SFN induces peroxisomal lengthening. (A) RPE-1 cells were transfected with 10 nM of the indicated siRNA and 3 days later treated with DMSO or 50 ?M SFN for 4 h. Peroxisomes (green) were labeled with an anti-PMP70 antibody, mitochondria with MitoTracker (red), and DNA counterstained with DAPI. Enlarged insets of peroxisomes are shown on the right (panels d, h, and l) to facilitate visualization of the changes in morphology induced by SFN and Drp1 depletion. Arrowheads highlight constriction points. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).
We next determined how SFN restricts Drp1 function. Possibilities included reductions in expression levels, recruitment/retention at mitochondria, oligomerization, or enzymatic activity of the GTPase. A deficit in any one of these would result in reduced mitochondrial fission and hyperfusion. We did not detect reproducible changes in Drp1 protein levels after SFN-treatment (Figs. 1C and 3A), and therefore concluded that SFN does not alter Drp1 stability or expression, consistent with Drp1 having a half-life of >10 h [50] and our SFN treatments being of shorter duration. Next, we investigated whether SFN affected the recruitment or retention of Drp1 to mitochondria. Fractionation studies showed that SFN induced a loss of Drp1 from the mitochondrial fraction (Fig. 3A, lanes 7�8 and Fig. 3B). As reported previously [43], only a minor fraction of Drp1 (~3%) is associated with the mitochondrial network at any given time during steady state conditions with most of the enzyme residing in the cytoplasm (Fig. 3A, lanes 5�8). These fractionation data were confirmed using co-localization analysis which showed a ~40% reduction in mitochondria-localized, punctate Drp1 foci after SFN-treatment (Fig. 3C and D). Together, these data indicate that the mitochondrial fusion induced by SFN is, at least partially, due to the attenuated association of Drp1 with the mitochondria. Our data do not distinguish between whether SFN interferes with the mitochondrial recruitment versus the mitochondrial retention of Drp1, or both, as the analysis of endogenous Drp1 was not amenable to visualizing the GTPase by live-cell microscopy.
Figure 3 SFN causes a loss of Drp1 from the mitochondria. (A) Subcellular fractionation of RPE-1 cells following 4 h of DMSO or SFN. Whole-cell lysates (WCL), nuclear (Nuc), cytosolic (Cyto), and crude mitochondrial (Mito) fractions were resolved by SDS-PAGE and processed for western blotting with the indicated antibodies. The migration of molecular weight markers is indicated on the left. (B) Graphs showing densitometric quantification of Drp1 in the indicated fractions from (A). (C) RPE-1 cells were transfected with 10 nM siCON or siDrp1 and 3 days later treated with DMSO or SFN for 4 h. Drp1 (green) was visualized with an anti-Drp1 antibody, mitochondria with MitoTracker (red), and nuclei with DAPI (blue). (D) Automated co-localization analysis of Drp1 and MitoTracker signal from (C). Data in (B) and (D) were compiled from 3 and 5 independent experiments, respectively, and statistical significance was determined by two-tailed Student’s t-test. Error bars reflect +/- S.D and asterisks denote statistical significance. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).
Sulforaphane Confers Protection Against Staurosportine-Induced Apoptosis Independent of Nrf2
Previous work has shown that mitochondrial fission is permissive in the formation of pores in the outer mitochondrial membrane generated by Bax/Bak during apoptosis [11]. Drp1 has been shown to be selectively recruited to mitochondria during apoptosis [11] and, consistent with this, fragmented mitochondria have been observed early in the process [27]. Conversely, inhibiting mitochondrial fission is thought to inhibit apoptosis by blocking the formation of the outer membrane pores that allow for cytochrome c release [53]. Accordingly, stimulating mitochondrial fusion delays the progression of apoptosis induced by compounds including staurosporine (STS) [14]. To determine whether SFN protects RPE-1 cells from STS-mediated apoptosis and if so, whether this requires Nrf2, we established an assay to readily induce poly ADP ribose polymerase (PARP) cleavage, a substrate of activated caspase-3 and definitive marker of apoptosis. Treatment of RPE-1 cells with 1 �M STS for 6 h only caused a very modest cleavage of PARP yet this was prevented by SFN co-treatment (e.g., Fig. 4A, lane 3 versus 4). To increase the robustness of this assay, we further sensitized cells to STS-induced apoptosis by pre-treating them with siRNA targeting the anti-apoptotic factor, Bcl-XL. This pretreatment reduced the expression of Bcl-XL and markedly promoted PARP cleavage as a function of time exposed to STS (Fig. 4B, compare lane 2 to lanes 4�10). Importantly, 2 h of pre-treatment with SFN mitigated PARP cleavage in cells exposed to STS (Fig. 4C, lane 3 versus 4 and lane 5 versus 6). Likewise, cells stably depleted of Nrf2 by CRISPR/Cas9 were comparably protected from STS toxicity by SFN pre-treatment (Fig. 4C, lane 11 versus 12 and lane 13 versus 14 and Fig. 4D). This protection was observed using both PARP cleavage (Fig. 4C and D) and cellular morphology (Fig. 4E) as readouts. The efficacy of Nrf2 depletion by CRISPR/Cas9 was confirmed by western blotting (Fig. 4C, Nrf2 blot). As predicted, depleting cells of Drp1, which also yields a hyperfusion phenotype (Fig. 1A), also blocked PARP cleavage in response to STS as compared to control cells incubated with SFN (Fig. 4F and G). Together, these findings are consistent with SFN conferring protection against apoptosis through its capacity to restrict Drp1 function, independent of the stabilization and activation of Nrf2.
Figure 4 The cytoprotective effects of SFN are independent of Nrf2 expression (A) RPE-1 cells were pre-treated with DMSO or 50 ?M SFN for 2 h prior to treatment with DMSO, 1 ?M staurosporine (STS), or 50 ?M etoposide for 6 h and were processed for anti-PARP western blotting. (B) RPE-1 cells were transfected with 2.5 nM siCON, 1 nM siBcl-XL, or 2.5 nM siBcl-XL and 3 days later were treated with DMSO or 1 ?M STS for 2, 4, or 6 h. Representative western blots are shown and the migration of molecular weight markers is indicated on the left. (C) CRISPR/Cas9-generated wild-type (Nrf2WT) and Nrf2 knockout (Nrf2KO) RPE-1 cells were transfected with 1 nM siBcl-XL and 3 days later were pre-treated with DMSO or 50 ?M SFN for 2 h. Subsequently, the cells were treated with 1 ?M STS for 2, 4, or 6 h. Representative western blots with the indicated antibodies are shown. (D) Quantification of cleaved PARP as a percentage of total PARP (cleaved+uncleaved) from 3 independent experiments. Importantly, the levels of cleaved PARP were comparable whether cells expressed Nrf2 or not, indicating that SFN protection from STS is independent of the transcription factor. (E) 20X phase-contrast images taken immediately prior to harvest of lysates from (C). Scale bar=65 �m. (F) Representative western blots demonstrating that depletion of Drp1 confers near-comparable protection from STS as SFN treatment. RPE-1 cells were transfected with 1 nM siBcl-XL and additionally transfected with either 10 nM siCON or 10 nM siDrp1. 3 days later, siCON cells were pre-treated with SFN as in (A) and (C) and then exposed to STS for 4 h prior to being harvested and processed for western blotting with the indicated antibodies. (G) Same as (D) for the data presented in (F) compiled from 3 independent experiments. Error bars reflect +/- S.E.M.
Discussion
We have discovered that SFN modulates mitochondrial fission/fusion dynamics independent of its effects on the KEAP1-Nrf2-ARE pathway. This is intriguing because of an assumed link between mitochondrial dysfunction and ROS production and the necessity of squelching mitochondria-derived free radicals through the activation of Nrf2. This additional functional impact of SFN is of potential importance given the more than 30 clinical trials currently underway testing SFN for the treatment of a variety of diseases including prostate cancer, obstructive pulmonary disease, and sickle cell disease [7], [10], [47].
Because SFN is an isothiocyanate [56] and it activates Nrf2 signaling by directly acylating critical KEAP1 cysteines to suppress Nrf2 degradation [21], it follows that SFN exerts its pro-fusion effects by modulating the activity of a fission or fusion factor via cysteine modification. Our data strongly support Drp1 being negatively regulated by SFN although whether the GTPase is a direct target of acylation remains to be elucidated. Despite this knowledge gap, the function of Drp1 is clearly being compromised by SFN as both mitochondria and peroxisomes become hyperfused in response to SFN treatment and these organelles share Drp1 for their respective scission events [38]. In addition, SFN decreases the amount of Drp1 that localizes and accumulates at mitochondria (Fig. 3). Because our experiments were done with all endogenous proteins, our detection of Drp1 at mitochondrial fission sites is under steady-state conditions, and consequently, we cannot distinguish between a recruitment versus a retention defect of the enzyme caused by SFN. Further, we cannot eliminate the possibility that SFN acylates a receptor at the mitochondria (Fis1 or Mff) to block Drp1 recruitment yet, we suspect that Drp1 is directly modified. Drp1 has nine cysteines, eight of which reside within the Middle Domain that is required for oligomerization [3], and one of which resides in the GTPase Effector Domain (GED) at the C-terminus of Drp1. Direct acylation of any of these cysteines could cause an activity defect in Drp1 and therefore underlie the effect of SFN on mitochondrial dynamics. Notably, prior work suggests that defects in oligomerization and catalytic activity can abrogate the retention of Drp1 at the mitochondria [52]. Cys644 in the GED domain is a particularly attractive target based on previous work showing that mutation of this cysteine phenocopies mutations that impair Drp1 GTPase activity [4] and that this particular cysteine is modified by thiol-reactive electrophiles [9]. Resolution of this outstanding question will require mass spectrometric validation.In summary, we have identified a novel, cytoprotective function for the clinically-relevant compound SFN. In addition to activating the master anti-oxidant transcription factor Nrf2, SFN promotes mitochondrial and peroxisomal fusion, and this effect is independent of Nrf2. The mechanism underlying this phenomenon involves a reduction in the function of the GTPase Drp1, the primary mediator of mitochondrial and peroxisomal fission. A major consequence of SFN-mediated mitochondrial fusion is that cells become resistant to the toxic effects of the apoptosis inducer staurosporine. This additional cytoprotective action of SFN could be of particular clinical utility in the numerous neurodegenerative diseases for which age is the leading risk factor (e.g., Parkinson’s Disease, Alzheimer’s Disease, Age-related Macular Degeneration) as these maladies have been associated with apoptosis and reduced levels and/or dysregulation of Nrf2 [35], [36], [48]. Together, these data demonstrate that the cytoprotective properties of SFN extend beyond activation of the KEAP1-Nrf2-ARE system and warrant further studies given the current use of this agent in multiple clinical trials.
Materials and Methods
Apoptosis Assays
Cells were seeded and transfected with siRNA as indicated below. The cells were pre-treated with 50 ?M sulforaphane for 2 h to induce mitochondrial fusion and were then treated with 1 ?M staurosporine to induce apoptosis. At the time of harvest, media was collected in individual tubes and subjected to high speed centrifugation to pellet apoptotic cells. This cell pellet was combined with adherent cells and solubilized in 2 times-concentrated Laemmli buffer. Samples were subjected to anti-PARP western blotting.
CRISPR/Cas9 Construct Generation
To create LentiCRISPR/eCas9 1.1, LentiCRISPR v2 (addgene #52961) was first cut with Age1 and BamH1. Next, SpCas9 from eSpCas9 1.1 (addgene #71814) was PCR amplified with Age1 and BamH1 overhangs using the following primers (Forward AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, Reverse AAGCGCGGATCCCTTTTTCTTTTTTGCCTGGCCGG) and ligated into the cut vector above. sgRNA sequences were determined by using Benchling.com. Parameters were set to target the coding sequence with the highest on-target and lowest off-target scores. The following sequences (targeting sequence underlined, hs sgNFE2L2#1 sense CACCGCGACGGAAAGAGTATGAGC, antisense AAACGCTCATACTCTTTCCGTCGC; hs sgNFE2L2#2 sense CACCGGTTTCTGACTGGATGTGCT, antisense AAACAGCACATCCAGTCAGAAACC; hs sgNFE2L2#3 sense CACCGGAGTAGTTGGCAGATCCAC, antisense AAACGTGGATCTGCCAACTACTCC) were annealed and ligated into BsmB1 cut LentiCRISPR/eCas9 1.1. Lentivirally infected RPE-1 cells were selected with puromycin and maintained as a pooled population. Knockout was confirmed by immunofluorescence and western blotting.
Cell Culture and Transfections
Human retinal pigment epithelial cells transformed with telomerase (RPE-1) (ATCC) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) containing 1 g/L glucose supplemented with penicillin, streptomycin, 1X non-essential amino acid cocktail (Life Technologies), and 10% Fetal Bovine Serum (Life Technologies). For siRNA-transfections, 30,000�35,000 cells/mL were seeded overnight. Cells received 10 nM siRNA diluted in serum-free DMEM and combined with 0.3% Interferin transfection reagent (PolyPlus). For apoptosis sensitization, cells received 1 nM Bcl-XL siRNA. Cells were harvested 2�3 days post-transfection.
Chemicals, Antibodies, and siRNA Oligos
Antibodies against ?-tubulin (Cell Signaling), ?-tubulin (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (Cell Signaling), PMP70 (Abcam), and Tom20 (BD Biosciences) were used at 1:1000 dilutions for western blotting and for immunofluorescence. In-house, anti-Nrf2 rabbit antibody was used at 1:2000 for western blotting [34], [59]. Sulforaphane (Sigma) and staurosporine (Tocris) were used at 50 ?M and 1 ?M respectively. siRNAs against Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (Cell Signaling), and Bcl-XL (Cell Signaling) were used at 10 nM unless otherwise noted.
Immunofluorescence and in Vivo Labeling
Cells seeded on 18 mm glass coverslips were treated with vehicle or drug, fixed in 3.7% formaldehyde and then permeabilized in 0.2% Triton X-100/PBS on ice for 10 min. Primary antibodies were incubated in 3% bovine serum albumin (BSA) in PBS overnight at 4 �C. Following PBS washes, cells were incubated for 1 h in species-appropriate, Alexa488- or Alexa546-, conjugated secondary antibodies (diluted 1:1000) and 0.1 ?g/mL DAPI (Sigma) in 3% BSA/PBS. Mitochondria were visualized either by anti-Tom20 immunofluorescence or by incubating cells in 200 nM MitoTracker Red CMXRos (Molecular Probes, Inc.) in serum-free DMEM for 30 min at 37 �C prior to fixation.
Microscopy and Image Analysis
Immunofluorescence samples were viewed on an LSM710 Confocal microscope (Carl Zeiss). Micrographs were captured using 63X or 100X oil immersion objectives and images adjusted and enhanced using Adobe Photoshop CS6. Co-localization analysis was performed using Carl Zeiss LSM710 co-localization feature with thresholds manually set while blinded to the identity of the samples. Scale bars throughout, unless otherwise indicated, are 10 �m. Mitochondrial morphology was assessed by blinded scoring. If the mitochondria of a cell were maintained as multiple, round, discriminate puncta, the cell was scored as �fission�. If individual mitochondria were indistinguishable and the whole mitochondrial network appeared continuous, the cell was scored as �fusion�. All other cells, including those with clustering mitochondria, were scored as �intermediate�.
Subcellular Fractionations
RPE-1 cells were grown to confluence. Following a PBS wash, cells were subjected to centrifugation at 600�g for 10 min and resuspended in 600 ?L isolation buffer (210 mM Mannitol, 70 mM Sucrose, 5 mM MOPS, 1 mM EDTA pH 7.4+1 mM PMSF). The suspension was lysed 30 times in a Dounce homogenizer. A fraction of the homogenate was preserved as a �whole cell lysate.� The remainder was subjected to centrifugation at 800�g for 10 min to pellet nuclei. Supernatants were subjected to centrifugation at 1500�g for 10 min to clear remaining nuclei and unlysed cells. This supernatant was subjected to centrifugation at 15,000�g for 15 min to pellet mitochondria. The supernatant was preserved as the �cytosolic fraction�. The pellet was washed gently with PBS and resuspended in isolation buffer. The protein concentration of each fraction was measured by bicinchoninic acid (BCA) assay and equivalent amounts of protein were resolved by SDS-PAGE.
Western Blotting
Cells were washed in PBS and solubilized in 2 times concentrated Laemmli solubilizing buffer (100 mM Tris [pH 6.8], 2% SDS, 0.008% bromophenol blue, 2% 2-mercaptoethanol, 26.3% glycerol, and 0.001% Pyrinin Y). Lysates were boiled for 5 min prior to loading on sodium dodecyl sulfate (SDS) polyacrylamide gels. Proteins were transferred to nitrocellulose membranes and the membranes were blocked for 1 h in 5% Milk/TBST. Primary antibodies were diluted in 5% Milk/TBST and incubated with the blot overnight at 4 �C. Horseradish peroxidase (HRP)-conjugated secondary antibodies were diluted in 5% Milk/TBST. Blots were processed with enhanced chemiluminescence and densitometric quantifications were performed using ImageJ software.
Sulforaphane is a chemical from the isothiocyanate collection of organosulfur substances obtained from cruciferous vegetables, including broccoli, cabbage, cauliflower, kale, and collards, among others. Sulforaphane is produced when the enzyme myrosinase transforms glucoraphanin, a glucosinolate, into sulforaphane, also known as sulforaphane-glucosinolate. Broccoli sprouts and cauliflower have the highest concentration of glucoraphanin or the precursor to sulforaphane. Research studies have demonstrated that sulforaphane enhances the human body’s antioxidant capabilities to prevent various health issues. Dr. Alex Jimenez D.C., C.C.S.T. Insight
Sulforaphane and Its Effects on Cancer, Mortality, Aging, Brain and Behavior, Heart Disease & More
Isothiocyanates are some of the most important plant compounds you can get in your diet. In this video I make the most comprehensive case for them that has ever been made. Short attention span? Skip to your favorite topic by clicking one of the time points below. Full timeline below.
Key sections:
00:01:14 – Cancer and mortality
00:19:04 – Aging
00:26:30 – Brain and behavior
00:38:06 – Final recap
00:40:27 – Dose
Full timeline:
00:00:34 – Introduction of sulforaphane, a major focus of the video.
00:01:14 – Cruciferous vegetable consumption and reductions in all-cause mortality.
00:02:12 – Prostate cancer risk.
00:02:23 – Bladder cancer risk.
00:02:34 – Lung cancer in smokers risk.
00:02:48 – Breast cancer risk.
00:03:13 – Hypothetical: what if you already have cancer? (interventional)
00:03:35 – Plausible mechanism driving the cancer and mortality associative data.
00:04:38 – Sulforaphane and cancer.
00:05:32 – Animal evidence showing strong effect of broccoli sprout extract on bladder tumor development in rats.
00:06:06 – Effect of direct supplementation of sulforaphane in prostate cancer patients.
00:07:09 – Bioaccumulation of isothiocyanate metabolites in actual breast tissue.
00:08:32 – Inhibition of breast cancer stem cells.
00:08:53 – History lesson: brassicas were established as having health properties even in ancient Rome.
00:09:16 – Sulforaphane’s ability to enhance carcinogen excretion (benzene, acrolein).
00:09:51 – NRF2 as a genetic switch via antioxidant response elements.
00:10:10 – How NRF2 activation enhances carcinogen excretion via glutathione-S-conjugates.
00:10:34 – Brussels sprouts increase glutathione-S-transferase and reduce DNA damage.
00:11:20 – Broccoli sprout drink increases benzene excretion by 61%.
00:13:31 – Broccoli sprout homogenate increases antioxidant enzymes in the upper airway.
00:15:45 – Cruciferous vegetable consumption and heart disease mortality.
00:16:55 – Broccoli sprout powder improves blood lipids and overall heart disease risk in type 2 diabetics.
00:19:04 – Beginning of aging section.
00:19:21 – Sulforaphane-enriched diet enhances lifespan of beetles from 15 to 30% (in certain conditions).
00:20:34 – Importance of low inflammation for longevity.
00:22:05 – Cruciferous vegetables and broccoli sprout powder seem to reduce a wide variety of inflammatory markers in humans.
00:36:32 – Sulforaphane improves learning in model of type II diabetes in mice.
00:37:19 – Sulforaphane and duchenne muscular dystrophy.
00:37:44 – Myostatin inhibition in muscle satellite cells (in vitro).
00:38:06 – Late-video recap: mortality and cancer, DNA damage, oxidative stress and inflammation, benzene excretion, cardiovascular disease, type II diabetes, effects on the brain (depression, autism, schizophrenia, neurodegeneration), NRF2 pathway.
00:40:27 – Thoughts on figuring out a dose of broccoli sprouts or sulforaphane.
00:41:01 – Anecdotes on sprouting at home.
00:43:14 – On cooking temperatures and sulforaphane activity.
00:43:45 – Gut bacteria conversion of sulforaphane from glucoraphanin.
00:44:24 – Supplements work better when combined with active myrosinase from vegetables.
00:44:56 – Cooking techniques and cruciferous vegetables.
Heating Decreases Epithiospecifier Protein Activity and Increases Sulforaphane Formation in Broccoli
Abstract
Sulforaphane, an isothiocyanate from broccoli, is one of the most potent food-derived anticarcinogens. This compound is not present in the intact vegetable, rather it is formed from its glucosinolate precursor, glucoraphanin, by the action of myrosinase, a thioglucosidase enzyme, when broccoli tissue is crushed or chewed. However, a number of studies have demonstrated that sulforaphane yield from glucoraphanin is low, and that a non-bioactive nitrile analog, sulforaphane nitrile, is the primary hydrolysis product when plant tissue is crushed at room temperature. Recent evidence suggests that in Arabidopsis, nitrile formation from glucosinolates is controlled by a heat-sensitive protein, epithiospecifier protein (ESP), a non-catalytic cofactor of myrosinase. Our objectives were to examine the effects of heating broccoli florets and sprouts on sulforaphane and sulforaphane nitrile formation, to determine if broccoli contains ESP activity, then to correlate heat-dependent changes in ESP activity, sulforaphane content and bioactivity, as measured by induction of the phase II detoxification enzyme quinone reductase (QR) in cell culture. Heating fresh broccoli florets or broccoli sprouts to 60 �C prior to homogenization simultaneously increased sulforaphane formation and decreased sulforaphane nitrile formation. A significant loss of ESP activity paralleled the decrease in sulforaphane nitrile formation. Heating to 70 �C and above decreased the formation of both products in broccoli florets, but not in broccoli sprouts. The induction of QR in cultured mouse hepatoma Hepa lclc7 cells paralleled increases in sulforaphane formation.
Pre-heating broccoli florets and sprouts to 60 �C significantly increased the myrosinase-catalyzed formation of sulforaphane (SF) in vegetable tissue extracts after crushing. This was associated with decreases in sulforaphane nitrile (SF Nitrile) formation and epithiospecifier protein (ESP) activity.
In conclusion, sulforaphane is a phytochemical found in broccoli,and other cruciferous vegetables. An uncontrolled amount of oxidants caused by both internal and external factors can cause oxidative stress in the human body which may ultimately lead to a variety of health issues. Sulforaphane can activate the production of Nrf2, a transcription factor that helps regulate�protective antioxidant mechanisms that control the cell’s response to oxidants. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Back pain�is one of the most prevalent causes of disability and missed days at work worldwide. Back pain attributes to the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments, and muscles, among other soft tissues. Because of this, injuries and/or aggravated conditions, such as�herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief.
IFM's Find A Practitioner tool is the largest referral network in Functional Medicine, created to help patients locate Functional Medicine practitioners anywhere in the world. IFM Certified Practitioners are listed first in the search results, given their extensive education in Functional Medicine