Sulforaphane is a phytochemical, a substance within the isothiocyanate group of organosulfur compounds, found in cruciferous vegetables, such as broccoli, cabbage, cauliflower, and Brussels sprouts. It can also be found in bok choy, kale, collards, mustard greens and watercress. Research studies have shown that sulforaphane can help prevent various types of cancer by activating the production of Nrf2, or nuclear factor erythroid 2-related factor, a transcription factor which regulates�protective antioxidant mechanisms that control the cell’s response to oxidants. The purpose of the following article is to describe the function of sulforaphane.
Abstract
The KEAP1-Nrf2-ARE antioxidant system is a principal means by which cells respond to oxidative and xenobiotic stresses. Sulforaphane (SFN), an electrophilic isothiocyanate derived from cruciferous vegetables, activates the KEAP1-Nrf2-ARE pathway and has become a molecule-of-interest in the treatment of diseases in which chronic oxidative stress plays a major etiological role. We demonstrate here that the mitochondria of cultured, human retinal pigment epithelial (RPE-1) cells treated with SFN undergo hyperfusion that is independent of both Nrf2 and its cytoplasmic inhibitor KEAP1. Mitochondrial fusion has been reported to be cytoprotective by inhibiting pore formation in mitochondria during apoptosis, and consistent with this, we show Nrf2-independent, cytoprotection of SFN-treated cells exposed to the apoptosis-inducer, staurosporine. Mechanistically, SFN mitigates the recruitment and/or retention of the soluble fission factor Drp1 to mitochondria and to peroxisomes but does not affect overall Drp1 abundance. These data demonstrate that the beneficial properties of SFN extend beyond the activation of the KEAP1-Nrf2-ARE system and warrant further interrogation given the current use of this agent in multiple clinical trials.
Sulforaphane is an Nrf2-Independent Inhibitor of Mitochondrial Fission
Sulforaphane (SFN) is an isothiocyanate compound derived in the diet most commonly from cruciferous vegetables [56]. It is generated in plants as a xenobiotic response to predation via vesicular release of the hydrolytic enzyme myrosinase from damaged cells; this enzyme converts glucosinolates to isothiocyantes [42]. Over the last two decades, SFN has been extensively characterized for its reported anticancer, antioxidant, and antimicrobial properties [57]. Much of this efficacy has been attributed to the capacity of SFN to modulate the KEAP1-Nrf2-antioxidant response element (ARE) signaling pathway, although additional activities of the compound have been identified, including the inhibition of histone deacetylase activity and cell cycle progression [29]. Nrf2 is the master antioxidant transcription factor and under conditions of homeostasis, its stability is suppressed through the action of the cytoplasmic Cullin3KEAP1 ubiquitin ligase complex [20]. Specifically, Nrf2 is recruited to the Cullin3KEAP1 ligase by binding to the dimeric substrate adaptor KEAP1 and is subsequently modified with polyUb chains that target the transcription factor for proteasome-mediated degradation. This constitutive turnover limits the half-life of Nrf2 in unstressed cells to ~15 min [30], [33], [46], [55]. In response to numerous types of stress, most notably oxidative stress, KEAP1, a cysteine-rich protein, acts as a redox sensor, and oxidative modification of critical cysteines, particularly C151, of KEAP1 dissociates Nrf2-KEAP1 from CUL3 thereby preventing Nrf2 degradation [8], [20], [55]. Notably, SFN, and possibly other Nrf2 activators, mimic oxidative stress by modifying C151 of KEAP1 e.g. [21]. Stabilization of Nrf2 allows for its translocation to the nucleus where it induces the expression of a battery of Phase II antioxidant and detoxification genes. Nrf2 binds to the antioxidant response promoter elements (ARE) of its cognate target genes through heterodimerization with small Maf proteins [19]. This system presents a dynamic and sensitive response to indirect antioxidants like SFN, free radicals generated by the mitochondria [16], or other physiologic sources of oxidative stress [41].
Mitochondria are dynamic, subcellular organelles that regulate a host of cellular functions ranging from ATP production and intracellular calcium buffering to redox regulation and apoptosis [13], [49]. Mitochondria also represent the principal source of reactive oxygen species (ROS) within the cell. Proper regulation of mitochondrial function is therefore necessary for optimizing ATP production to meet cellular needs while simultaneously minimizing the potentially harmful effects of excessive free radical production. A critical requirement for fine modulation of mitochondrial function is the capacity for mitochondria to function both independently as biochemical machines and as part of a vast, responsive network.
Mitochondrial network morphology and function are determined by a regulated balance between fission and fusion. Mitochondrial fission is required for daughter cell inheritance of mitochondria during cell division [28] as well as for the selective, autophagic degradation of depolarized or damaged mitochondria, termed mitophagy [1]. Conversely, fusion is required for complementation of mitochondrial genomes and sharing of electron transport chain components between neighboring mitochondria [54]. At the molecular level, mitochondrial fission and fusion are regulated by large, dynamin-like GTPases. Three enzymes primarily regulate fusion: Mitofusins 1 and 2 (Mfn1/2) are two-pass outer membrane proteins that mediate outer membrane fusion via heterotypic interactions between adjacent mitochondria [15], [25], [37], while OPA1 is an inner membrane protein that simultaneously ensures matrix connectivity by regulating the melding of inner membranes [5]. The GTPase activity of all three proteins is required for robust fusion [5], [18], and OPA1 is further regulated by complex proteolysis within the mitochondrial inner membrane by the proteases OMA1 [14], PARL [6], and YME1L [45]. Importantly, intact mitochondrial membrane potential is required for efficient fusion in order to suppress integration of damaged and healthy mitochondria [26].
Mitochondrial fission is primarily catalyzed by a cytosolic protein called Dynamin-related protein 1 (Drp1/DNM1L). Drp1 is recruited from the cytosol to prospective sites of fission on the mitochondrial outer membrane [43]. The major receptors for Drp1 on the outer membrane are mitochondrial fission factor (Mff) [32] and, to a lesser extent, Fission 1 (Fis1) [51]. Additionally, a decoy receptor, MIEF1/MiD51, was discovered that acts to further limit the activity of Drp1 protein at potential fission sites [58]. Once docked at the mitochondrial outer membrane, Drp1 oligomerizes into spiral-like structures around the body of the mitochondrion and then utilizes the energy derived from GTP hydrolysis to mediate the physical scission of the mitochondrial outer and inner membranes [17]. Endoplasmic reticulum-derived tubules act as an initial constrictor of mitochondria prior to Drp1 oligomerization, underscoring the revelation that non-constricted mitochondria are wider than the permissive circumference of a completed Drp1 spiral [12]. Actin dynamics are also important for the ER-mitochondria interactions that precede mitochondrial fission [24]. In addition to its role in mitochondrial fission, Drp1 catalyzes the fission of peroxisomes [40].
Drp1 is very similar to the well-characterized dynamin protein in that both proteins contain an N-terminal GTPase domain, a Middle domain that is critical for self-oligomerization, and a C-terminal GTPase effector domain [31]. Drp1 achieves selectivity for mitochondrial membranes through a combination of interactions with its receptor proteins Mff and Fis1 and also through its affinity for the mitochondria-specific phospholipid cardiolipin via the unique B-insert domain of Drp1 [2]. Drp1 typically exists as a homotetramer in the cytoplasm, and higher order assembly at mitochondrial fission sites is mediated by the Middle domain of Drp1 [3].
Given the implicit link between mitochondrial function and the KEAP1-Nrf2-ARE pathway, we investigated the effects of Nrf2 activation on mitochondrial structure and function. We demonstrate here that SFN induces mitochondrial hyperfusion that, unexpectedly, is independent of both Nrf2 and KEAP1. This effect of SFN is through an inhibition of Drp1 function. We further demonstrate that SFN confers resistance to apoptosis that is Nrf2-independent and mimics that observed in cells depleted of Drp1. These data collectively indicate that in addition to stabilizing and activating Nrf2, SFN modulates mitochondrial dynamics and preserves cellular fitness and survival.
Results
Sulforaphane Induces Nrf2/KEAP1-Independent Hyperfusion of Mitochondria
In the course of studying the effects of Nrf2 activation on mitochondrial network dynamics, we discovered that treatment of immortalized, human retinal pigment epithelial (RPE-1) cells with sulforaphane (SFN), a potent activator of Nrf2 signaling, induced a robust fusion of the mitochondrial network when compared with vehicle-treated control cells (Fig. 1A and B). The morphology of the mitochondria in these cells greatly resembled that of the mitochondria in cells depleted by siRNA of endogenous Drp1, the principal mitochondrial fission factor (Fig. 1A). This result raised the intriguing idea that mitochondrial fission and fusion status responds directly to Nrf2 levels in the cell. However, stimulation of cells with other Nrf2 stabilizers and activators such as the proteasome inhibitor MG132, the pro-oxidant tBHQ, or knockdown of the Nrf2 inhibitor KEAP1 did not induce mitochondrial fusion (Fig. 1A and B). Stabilization of Nrf2 by these manipulations was confirmed by western blotting for endogenous Nrf2 (Fig. 1C). Furthermore, expression of Nrf2 was dispensable for SFN-induced mitochondrial fusion, as knockdown of endogenous Nrf2 with siRNA failed to counter this phenotype (Fig. 1D�F). Because SFN stimulates the KEAP1-Nrf2-ARE pathway by covalently modifying cysteine residues of KEAP1 [21], we knocked down KEAP1 to address whether SFN-induced mitochondrial hyperfusion is stimulated through a KEAP1-dependent, but Nrf2 independent pathway. However, depletion of KEAP1 also failed to abrogate SFN-induced mitochondrial fusion (Fig. 1G�I). In fact, SFN reversed the pro-fission morphology induced by depletion of KEAP1 (Fig. 1G, panel b versus panel d). These results indicate that SFN treatment causes mitochondrial fusion independent of the canonical KEAP1-Nrf2-ARE pathway and led us to interrogate whether SFN directly affects components of the mitochondrial fission or fusion machinery.
Figure 1 SFN induces Nrf2/KEAP1-independent mitochondrial fusion. (A) RPE-1 cells were transfected with the indicated siRNAs and 3 days later treated with DMSO or the Nrf2 activators SFN (50 ?M), MG132 (10 ?M), or tBHQ (100 ?M) for 4 h. Mitochondria (red) are labeled with an anti-Tom20 antibody, and nuclei (blue) are counterstained with DAPI. (B) Graph showing quantification of mitochondrial morphology scoring from (A). >50 cells per condition were evaluated in a blinded fashion. (C) Representative western blots from (A). (D) RPE-1 cells were transfected with 10 nM siRNA and 3 days later treated with SFN for 4 h prior to being fixed and stained as in (A). (E) Graph showing quantification of mitochondrial phenotype scoring from (D). >100 cells per condition were evaluated in a blinded fashion. (F) Representative western blots from (D). (G) Cells were transfected and treated as in (D) with siCON or siKEAP1. (H) Cells from (G) were scored as in (B) and (E) on the basis of mitochondrial morphology. (I) Representative western blots from (G). Data in (B), (E), and (H) were compiled from 3 independent experiments each and statistical significance was determined by two-tailed Student’s t-test. Error bars reflect +/- S.D. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).
Sulforaphane Impairs the Mitochondrial Association of Drp1
Based on the finding that SFN-treatment induces mitochondrial hyperfusion, we reasoned that this phenotype was either a consequence of excessive fusion activity or an inhibition of fission activity. To discriminate between these two possibilities, we compared the morphology of peroxisomes in the presence and absence of SFN. Peroxisomes are similar to mitochondria in that they are dynamic organelles the shape and length of which are constantly in flux [44]. Peroxisomes contain both Fis1 and Mff in their outer membrane and, as a consequence, are targets for Drp1-mediated fission [22], [23]. However, peroxisomes do not utilize the fusion machinery of the mitochondrial network and consequently, do not undergo fusion [39]. Rather, peroxisomal fission is opposed by the lengthening of existing peroxisomes via de novo addition of membranes and proteins [44]. Because peroxisomes lack Mfn1/2 and OPA1, we reasoned that if SFN activates the fusion machinery rather than inhibiting the fission machinery, peroxisome length would not be affected. In vehicle-treated cells, peroxisomes are maintained as short, round, punctiform organelles (Fig. 2, panels b and d). However, SFN treatment increased peroxisome length by ~2-fold as compared to control cells (Fig. 2, panels f and h). Furthermore, many of the peroxisomes were pinched near the center, indicating a potential scission defect (Fig. 2, panel h, arrowheads). Likewise, peroxisomes in cells transfected with Drp1 siRNA were abnormally long (Fig. 2, panels j and l), confirming that Drp1 is required for peroxisomal fission and suggesting that SFN-treatment causes mitochondrial and peroxisomal phenotypes by disrupting the fission machinery.
Figure 2 SFN induces peroxisomal lengthening. (A) RPE-1 cells were transfected with 10 nM of the indicated siRNA and 3 days later treated with DMSO or 50 ?M SFN for 4 h. Peroxisomes (green) were labeled with an anti-PMP70 antibody, mitochondria with MitoTracker (red), and DNA counterstained with DAPI. Enlarged insets of peroxisomes are shown on the right (panels d, h, and l) to facilitate visualization of the changes in morphology induced by SFN and Drp1 depletion. Arrowheads highlight constriction points. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).
We next determined how SFN restricts Drp1 function. Possibilities included reductions in expression levels, recruitment/retention at mitochondria, oligomerization, or enzymatic activity of the GTPase. A deficit in any one of these would result in reduced mitochondrial fission and hyperfusion. We did not detect reproducible changes in Drp1 protein levels after SFN-treatment (Figs. 1C and 3A), and therefore concluded that SFN does not alter Drp1 stability or expression, consistent with Drp1 having a half-life of >10 h [50] and our SFN treatments being of shorter duration. Next, we investigated whether SFN affected the recruitment or retention of Drp1 to mitochondria. Fractionation studies showed that SFN induced a loss of Drp1 from the mitochondrial fraction (Fig. 3A, lanes 7�8 and Fig. 3B). As reported previously [43], only a minor fraction of Drp1 (~3%) is associated with the mitochondrial network at any given time during steady state conditions with most of the enzyme residing in the cytoplasm (Fig. 3A, lanes 5�8). These fractionation data were confirmed using co-localization analysis which showed a ~40% reduction in mitochondria-localized, punctate Drp1 foci after SFN-treatment (Fig. 3C and D). Together, these data indicate that the mitochondrial fusion induced by SFN is, at least partially, due to the attenuated association of Drp1 with the mitochondria. Our data do not distinguish between whether SFN interferes with the mitochondrial recruitment versus the mitochondrial retention of Drp1, or both, as the analysis of endogenous Drp1 was not amenable to visualizing the GTPase by live-cell microscopy.
Figure 3 SFN causes a loss of Drp1 from the mitochondria. (A) Subcellular fractionation of RPE-1 cells following 4 h of DMSO or SFN. Whole-cell lysates (WCL), nuclear (Nuc), cytosolic (Cyto), and crude mitochondrial (Mito) fractions were resolved by SDS-PAGE and processed for western blotting with the indicated antibodies. The migration of molecular weight markers is indicated on the left. (B) Graphs showing densitometric quantification of Drp1 in the indicated fractions from (A). (C) RPE-1 cells were transfected with 10 nM siCON or siDrp1 and 3 days later treated with DMSO or SFN for 4 h. Drp1 (green) was visualized with an anti-Drp1 antibody, mitochondria with MitoTracker (red), and nuclei with DAPI (blue). (D) Automated co-localization analysis of Drp1 and MitoTracker signal from (C). Data in (B) and (D) were compiled from 3 and 5 independent experiments, respectively, and statistical significance was determined by two-tailed Student’s t-test. Error bars reflect +/- S.D and asterisks denote statistical significance. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).
Sulforaphane Confers Protection Against Staurosportine-Induced Apoptosis Independent of Nrf2
Previous work has shown that mitochondrial fission is permissive in the formation of pores in the outer mitochondrial membrane generated by Bax/Bak during apoptosis [11]. Drp1 has been shown to be selectively recruited to mitochondria during apoptosis [11] and, consistent with this, fragmented mitochondria have been observed early in the process [27]. Conversely, inhibiting mitochondrial fission is thought to inhibit apoptosis by blocking the formation of the outer membrane pores that allow for cytochrome c release [53]. Accordingly, stimulating mitochondrial fusion delays the progression of apoptosis induced by compounds including staurosporine (STS) [14]. To determine whether SFN protects RPE-1 cells from STS-mediated apoptosis and if so, whether this requires Nrf2, we established an assay to readily induce poly ADP ribose polymerase (PARP) cleavage, a substrate of activated caspase-3 and definitive marker of apoptosis. Treatment of RPE-1 cells with 1 �M STS for 6 h only caused a very modest cleavage of PARP yet this was prevented by SFN co-treatment (e.g., Fig. 4A, lane 3 versus 4). To increase the robustness of this assay, we further sensitized cells to STS-induced apoptosis by pre-treating them with siRNA targeting the anti-apoptotic factor, Bcl-XL. This pretreatment reduced the expression of Bcl-XL and markedly promoted PARP cleavage as a function of time exposed to STS (Fig. 4B, compare lane 2 to lanes 4�10). Importantly, 2 h of pre-treatment with SFN mitigated PARP cleavage in cells exposed to STS (Fig. 4C, lane 3 versus 4 and lane 5 versus 6). Likewise, cells stably depleted of Nrf2 by CRISPR/Cas9 were comparably protected from STS toxicity by SFN pre-treatment (Fig. 4C, lane 11 versus 12 and lane 13 versus 14 and Fig. 4D). This protection was observed using both PARP cleavage (Fig. 4C and D) and cellular morphology (Fig. 4E) as readouts. The efficacy of Nrf2 depletion by CRISPR/Cas9 was confirmed by western blotting (Fig. 4C, Nrf2 blot). As predicted, depleting cells of Drp1, which also yields a hyperfusion phenotype (Fig. 1A), also blocked PARP cleavage in response to STS as compared to control cells incubated with SFN (Fig. 4F and G). Together, these findings are consistent with SFN conferring protection against apoptosis through its capacity to restrict Drp1 function, independent of the stabilization and activation of Nrf2.
Figure 4 The cytoprotective effects of SFN are independent of Nrf2 expression (A) RPE-1 cells were pre-treated with DMSO or 50 ?M SFN for 2 h prior to treatment with DMSO, 1 ?M staurosporine (STS), or 50 ?M etoposide for 6 h and were processed for anti-PARP western blotting. (B) RPE-1 cells were transfected with 2.5 nM siCON, 1 nM siBcl-XL, or 2.5 nM siBcl-XL and 3 days later were treated with DMSO or 1 ?M STS for 2, 4, or 6 h. Representative western blots are shown and the migration of molecular weight markers is indicated on the left. (C) CRISPR/Cas9-generated wild-type (Nrf2WT) and Nrf2 knockout (Nrf2KO) RPE-1 cells were transfected with 1 nM siBcl-XL and 3 days later were pre-treated with DMSO or 50 ?M SFN for 2 h. Subsequently, the cells were treated with 1 ?M STS for 2, 4, or 6 h. Representative western blots with the indicated antibodies are shown. (D) Quantification of cleaved PARP as a percentage of total PARP (cleaved+uncleaved) from 3 independent experiments. Importantly, the levels of cleaved PARP were comparable whether cells expressed Nrf2 or not, indicating that SFN protection from STS is independent of the transcription factor. (E) 20X phase-contrast images taken immediately prior to harvest of lysates from (C). Scale bar=65 �m. (F) Representative western blots demonstrating that depletion of Drp1 confers near-comparable protection from STS as SFN treatment. RPE-1 cells were transfected with 1 nM siBcl-XL and additionally transfected with either 10 nM siCON or 10 nM siDrp1. 3 days later, siCON cells were pre-treated with SFN as in (A) and (C) and then exposed to STS for 4 h prior to being harvested and processed for western blotting with the indicated antibodies. (G) Same as (D) for the data presented in (F) compiled from 3 independent experiments. Error bars reflect +/- S.E.M.
Discussion
We have discovered that SFN modulates mitochondrial fission/fusion dynamics independent of its effects on the KEAP1-Nrf2-ARE pathway. This is intriguing because of an assumed link between mitochondrial dysfunction and ROS production and the necessity of squelching mitochondria-derived free radicals through the activation of Nrf2. This additional functional impact of SFN is of potential importance given the more than 30 clinical trials currently underway testing SFN for the treatment of a variety of diseases including prostate cancer, obstructive pulmonary disease, and sickle cell disease [7], [10], [47].
Because SFN is an isothiocyanate [56] and it activates Nrf2 signaling by directly acylating critical KEAP1 cysteines to suppress Nrf2 degradation [21], it follows that SFN exerts its pro-fusion effects by modulating the activity of a fission or fusion factor via cysteine modification. Our data strongly support Drp1 being negatively regulated by SFN although whether the GTPase is a direct target of acylation remains to be elucidated. Despite this knowledge gap, the function of Drp1 is clearly being compromised by SFN as both mitochondria and peroxisomes become hyperfused in response to SFN treatment and these organelles share Drp1 for their respective scission events [38]. In addition, SFN decreases the amount of Drp1 that localizes and accumulates at mitochondria (Fig. 3). Because our experiments were done with all endogenous proteins, our detection of Drp1 at mitochondrial fission sites is under steady-state conditions, and consequently, we cannot distinguish between a recruitment versus a retention defect of the enzyme caused by SFN. Further, we cannot eliminate the possibility that SFN acylates a receptor at the mitochondria (Fis1 or Mff) to block Drp1 recruitment yet, we suspect that Drp1 is directly modified. Drp1 has nine cysteines, eight of which reside within the Middle Domain that is required for oligomerization [3], and one of which resides in the GTPase Effector Domain (GED) at the C-terminus of Drp1. Direct acylation of any of these cysteines could cause an activity defect in Drp1 and therefore underlie the effect of SFN on mitochondrial dynamics. Notably, prior work suggests that defects in oligomerization and catalytic activity can abrogate the retention of Drp1 at the mitochondria [52]. Cys644 in the GED domain is a particularly attractive target based on previous work showing that mutation of this cysteine phenocopies mutations that impair Drp1 GTPase activity [4] and that this particular cysteine is modified by thiol-reactive electrophiles [9]. Resolution of this outstanding question will require mass spectrometric validation.In summary, we have identified a novel, cytoprotective function for the clinically-relevant compound SFN. In addition to activating the master anti-oxidant transcription factor Nrf2, SFN promotes mitochondrial and peroxisomal fusion, and this effect is independent of Nrf2. The mechanism underlying this phenomenon involves a reduction in the function of the GTPase Drp1, the primary mediator of mitochondrial and peroxisomal fission. A major consequence of SFN-mediated mitochondrial fusion is that cells become resistant to the toxic effects of the apoptosis inducer staurosporine. This additional cytoprotective action of SFN could be of particular clinical utility in the numerous neurodegenerative diseases for which age is the leading risk factor (e.g., Parkinson’s Disease, Alzheimer’s Disease, Age-related Macular Degeneration) as these maladies have been associated with apoptosis and reduced levels and/or dysregulation of Nrf2 [35], [36], [48]. Together, these data demonstrate that the cytoprotective properties of SFN extend beyond activation of the KEAP1-Nrf2-ARE system and warrant further studies given the current use of this agent in multiple clinical trials.
Materials and Methods
Apoptosis Assays
Cells were seeded and transfected with siRNA as indicated below. The cells were pre-treated with 50 ?M sulforaphane for 2 h to induce mitochondrial fusion and were then treated with 1 ?M staurosporine to induce apoptosis. At the time of harvest, media was collected in individual tubes and subjected to high speed centrifugation to pellet apoptotic cells. This cell pellet was combined with adherent cells and solubilized in 2 times-concentrated Laemmli buffer. Samples were subjected to anti-PARP western blotting.
CRISPR/Cas9 Construct Generation
To create LentiCRISPR/eCas9 1.1, LentiCRISPR v2 (addgene #52961) was first cut with Age1 and BamH1. Next, SpCas9 from eSpCas9 1.1 (addgene #71814) was PCR amplified with Age1 and BamH1 overhangs using the following primers (Forward AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, Reverse AAGCGCGGATCCCTTTTTCTTTTTTGCCTGGCCGG) and ligated into the cut vector above. sgRNA sequences were determined by using Benchling.com. Parameters were set to target the coding sequence with the highest on-target and lowest off-target scores. The following sequences (targeting sequence underlined, hs sgNFE2L2#1 sense CACCGCGACGGAAAGAGTATGAGC, antisense AAACGCTCATACTCTTTCCGTCGC; hs sgNFE2L2#2 sense CACCGGTTTCTGACTGGATGTGCT, antisense AAACAGCACATCCAGTCAGAAACC; hs sgNFE2L2#3 sense CACCGGAGTAGTTGGCAGATCCAC, antisense AAACGTGGATCTGCCAACTACTCC) were annealed and ligated into BsmB1 cut LentiCRISPR/eCas9 1.1. Lentivirally infected RPE-1 cells were selected with puromycin and maintained as a pooled population. Knockout was confirmed by immunofluorescence and western blotting.
Cell Culture and Transfections
Human retinal pigment epithelial cells transformed with telomerase (RPE-1) (ATCC) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) containing 1 g/L glucose supplemented with penicillin, streptomycin, 1X non-essential amino acid cocktail (Life Technologies), and 10% Fetal Bovine Serum (Life Technologies). For siRNA-transfections, 30,000�35,000 cells/mL were seeded overnight. Cells received 10 nM siRNA diluted in serum-free DMEM and combined with 0.3% Interferin transfection reagent (PolyPlus). For apoptosis sensitization, cells received 1 nM Bcl-XL siRNA. Cells were harvested 2�3 days post-transfection.
Chemicals, Antibodies, and siRNA Oligos
Antibodies against ?-tubulin (Cell Signaling), ?-tubulin (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (Cell Signaling), PMP70 (Abcam), and Tom20 (BD Biosciences) were used at 1:1000 dilutions for western blotting and for immunofluorescence. In-house, anti-Nrf2 rabbit antibody was used at 1:2000 for western blotting [34], [59]. Sulforaphane (Sigma) and staurosporine (Tocris) were used at 50 ?M and 1 ?M respectively. siRNAs against Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (Cell Signaling), and Bcl-XL (Cell Signaling) were used at 10 nM unless otherwise noted.
Immunofluorescence and in Vivo Labeling
Cells seeded on 18 mm glass coverslips were treated with vehicle or drug, fixed in 3.7% formaldehyde and then permeabilized in 0.2% Triton X-100/PBS on ice for 10 min. Primary antibodies were incubated in 3% bovine serum albumin (BSA) in PBS overnight at 4 �C. Following PBS washes, cells were incubated for 1 h in species-appropriate, Alexa488- or Alexa546-, conjugated secondary antibodies (diluted 1:1000) and 0.1 ?g/mL DAPI (Sigma) in 3% BSA/PBS. Mitochondria were visualized either by anti-Tom20 immunofluorescence or by incubating cells in 200 nM MitoTracker Red CMXRos (Molecular Probes, Inc.) in serum-free DMEM for 30 min at 37 �C prior to fixation.
Microscopy and Image Analysis
Immunofluorescence samples were viewed on an LSM710 Confocal microscope (Carl Zeiss). Micrographs were captured using 63X or 100X oil immersion objectives and images adjusted and enhanced using Adobe Photoshop CS6. Co-localization analysis was performed using Carl Zeiss LSM710 co-localization feature with thresholds manually set while blinded to the identity of the samples. Scale bars throughout, unless otherwise indicated, are 10 �m. Mitochondrial morphology was assessed by blinded scoring. If the mitochondria of a cell were maintained as multiple, round, discriminate puncta, the cell was scored as �fission�. If individual mitochondria were indistinguishable and the whole mitochondrial network appeared continuous, the cell was scored as �fusion�. All other cells, including those with clustering mitochondria, were scored as �intermediate�.
Subcellular Fractionations
RPE-1 cells were grown to confluence. Following a PBS wash, cells were subjected to centrifugation at 600�g for 10 min and resuspended in 600 ?L isolation buffer (210 mM Mannitol, 70 mM Sucrose, 5 mM MOPS, 1 mM EDTA pH 7.4+1 mM PMSF). The suspension was lysed 30 times in a Dounce homogenizer. A fraction of the homogenate was preserved as a �whole cell lysate.� The remainder was subjected to centrifugation at 800�g for 10 min to pellet nuclei. Supernatants were subjected to centrifugation at 1500�g for 10 min to clear remaining nuclei and unlysed cells. This supernatant was subjected to centrifugation at 15,000�g for 15 min to pellet mitochondria. The supernatant was preserved as the �cytosolic fraction�. The pellet was washed gently with PBS and resuspended in isolation buffer. The protein concentration of each fraction was measured by bicinchoninic acid (BCA) assay and equivalent amounts of protein were resolved by SDS-PAGE.
Western Blotting
Cells were washed in PBS and solubilized in 2 times concentrated Laemmli solubilizing buffer (100 mM Tris [pH 6.8], 2% SDS, 0.008% bromophenol blue, 2% 2-mercaptoethanol, 26.3% glycerol, and 0.001% Pyrinin Y). Lysates were boiled for 5 min prior to loading on sodium dodecyl sulfate (SDS) polyacrylamide gels. Proteins were transferred to nitrocellulose membranes and the membranes were blocked for 1 h in 5% Milk/TBST. Primary antibodies were diluted in 5% Milk/TBST and incubated with the blot overnight at 4 �C. Horseradish peroxidase (HRP)-conjugated secondary antibodies were diluted in 5% Milk/TBST. Blots were processed with enhanced chemiluminescence and densitometric quantifications were performed using ImageJ software.
Sulforaphane is a chemical from the isothiocyanate collection of organosulfur substances obtained from cruciferous vegetables, including broccoli, cabbage, cauliflower, kale, and collards, among others. Sulforaphane is produced when the enzyme myrosinase transforms glucoraphanin, a glucosinolate, into sulforaphane, also known as sulforaphane-glucosinolate. Broccoli sprouts and cauliflower have the highest concentration of glucoraphanin or the precursor to sulforaphane. Research studies have demonstrated that sulforaphane enhances the human body’s antioxidant capabilities to prevent various health issues. Dr. Alex Jimenez D.C., C.C.S.T. Insight
Sulforaphane and Its Effects on Cancer, Mortality, Aging, Brain and Behavior, Heart Disease & More
Isothiocyanates are some of the most important plant compounds you can get in your diet. In this video I make the most comprehensive case for them that has ever been made. Short attention span? Skip to your favorite topic by clicking one of the time points below. Full timeline below.
Key sections:
00:01:14 – Cancer and mortality
00:19:04 – Aging
00:26:30 – Brain and behavior
00:38:06 – Final recap
00:40:27 – Dose
Full timeline:
00:00:34 – Introduction of sulforaphane, a major focus of the video.
00:01:14 – Cruciferous vegetable consumption and reductions in all-cause mortality.
00:02:12 – Prostate cancer risk.
00:02:23 – Bladder cancer risk.
00:02:34 – Lung cancer in smokers risk.
00:02:48 – Breast cancer risk.
00:03:13 – Hypothetical: what if you already have cancer? (interventional)
00:03:35 – Plausible mechanism driving the cancer and mortality associative data.
00:04:38 – Sulforaphane and cancer.
00:05:32 – Animal evidence showing strong effect of broccoli sprout extract on bladder tumor development in rats.
00:06:06 – Effect of direct supplementation of sulforaphane in prostate cancer patients.
00:07:09 – Bioaccumulation of isothiocyanate metabolites in actual breast tissue.
00:08:32 – Inhibition of breast cancer stem cells.
00:08:53 – History lesson: brassicas were established as having health properties even in ancient Rome.
00:09:16 – Sulforaphane’s ability to enhance carcinogen excretion (benzene, acrolein).
00:09:51 – NRF2 as a genetic switch via antioxidant response elements.
00:10:10 – How NRF2 activation enhances carcinogen excretion via glutathione-S-conjugates.
00:10:34 – Brussels sprouts increase glutathione-S-transferase and reduce DNA damage.
00:11:20 – Broccoli sprout drink increases benzene excretion by 61%.
00:13:31 – Broccoli sprout homogenate increases antioxidant enzymes in the upper airway.
00:15:45 – Cruciferous vegetable consumption and heart disease mortality.
00:16:55 – Broccoli sprout powder improves blood lipids and overall heart disease risk in type 2 diabetics.
00:19:04 – Beginning of aging section.
00:19:21 – Sulforaphane-enriched diet enhances lifespan of beetles from 15 to 30% (in certain conditions).
00:20:34 – Importance of low inflammation for longevity.
00:22:05 – Cruciferous vegetables and broccoli sprout powder seem to reduce a wide variety of inflammatory markers in humans.
00:36:32 – Sulforaphane improves learning in model of type II diabetes in mice.
00:37:19 – Sulforaphane and duchenne muscular dystrophy.
00:37:44 – Myostatin inhibition in muscle satellite cells (in vitro).
00:38:06 – Late-video recap: mortality and cancer, DNA damage, oxidative stress and inflammation, benzene excretion, cardiovascular disease, type II diabetes, effects on the brain (depression, autism, schizophrenia, neurodegeneration), NRF2 pathway.
00:40:27 – Thoughts on figuring out a dose of broccoli sprouts or sulforaphane.
00:41:01 – Anecdotes on sprouting at home.
00:43:14 – On cooking temperatures and sulforaphane activity.
00:43:45 – Gut bacteria conversion of sulforaphane from glucoraphanin.
00:44:24 – Supplements work better when combined with active myrosinase from vegetables.
00:44:56 – Cooking techniques and cruciferous vegetables.
Heating Decreases Epithiospecifier Protein Activity and Increases Sulforaphane Formation in Broccoli
Abstract
Sulforaphane, an isothiocyanate from broccoli, is one of the most potent food-derived anticarcinogens. This compound is not present in the intact vegetable, rather it is formed from its glucosinolate precursor, glucoraphanin, by the action of myrosinase, a thioglucosidase enzyme, when broccoli tissue is crushed or chewed. However, a number of studies have demonstrated that sulforaphane yield from glucoraphanin is low, and that a non-bioactive nitrile analog, sulforaphane nitrile, is the primary hydrolysis product when plant tissue is crushed at room temperature. Recent evidence suggests that in Arabidopsis, nitrile formation from glucosinolates is controlled by a heat-sensitive protein, epithiospecifier protein (ESP), a non-catalytic cofactor of myrosinase. Our objectives were to examine the effects of heating broccoli florets and sprouts on sulforaphane and sulforaphane nitrile formation, to determine if broccoli contains ESP activity, then to correlate heat-dependent changes in ESP activity, sulforaphane content and bioactivity, as measured by induction of the phase II detoxification enzyme quinone reductase (QR) in cell culture. Heating fresh broccoli florets or broccoli sprouts to 60 �C prior to homogenization simultaneously increased sulforaphane formation and decreased sulforaphane nitrile formation. A significant loss of ESP activity paralleled the decrease in sulforaphane nitrile formation. Heating to 70 �C and above decreased the formation of both products in broccoli florets, but not in broccoli sprouts. The induction of QR in cultured mouse hepatoma Hepa lclc7 cells paralleled increases in sulforaphane formation.
Pre-heating broccoli florets and sprouts to 60 �C significantly increased the myrosinase-catalyzed formation of sulforaphane (SF) in vegetable tissue extracts after crushing. This was associated with decreases in sulforaphane nitrile (SF Nitrile) formation and epithiospecifier protein (ESP) activity.
In conclusion, sulforaphane is a phytochemical found in broccoli,and other cruciferous vegetables. An uncontrolled amount of oxidants caused by both internal and external factors can cause oxidative stress in the human body which may ultimately lead to a variety of health issues. Sulforaphane can activate the production of Nrf2, a transcription factor that helps regulate�protective antioxidant mechanisms that control the cell’s response to oxidants. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Back pain�is one of the most prevalent causes of disability and missed days at work worldwide. Back pain attributes to the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments, and muscles, among other soft tissues. Because of this, injuries and/or aggravated conditions, such as�herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief.
Oxidants are generally produced in a controlled manner in order to regulate essential processes in the human body, including cell division, inflammation, immune function, autophagy, and stress response. However, the uncontrolled production of these oxidants can contribute to oxidative stress, which may affect cellular function, leading to the development of toxicity, chronic disease and cancer. The human body’s protective antioxidant mechanisms are regulated by a series of vital pathways that control the cell’s response to oxidants. The nuclear factor erythroid 2-related factor, otherwise known as Nrf2, is an emerging regulator of cellular resistance to oxidants. The purpose of the article below is to discuss and demonstrate the emerging role of Nrf2 in mitochondrial function.
Abstract
The transcription factor NF-E2 p45-related factor 2 (Nrf2; gene name NFE2L2) allows adaptation and survival under conditions of stress by regulating the gene expression of diverse networks of cytoprotective proteins, including antioxidant, anti-inflammatory, and detoxification enzymes as well as proteins that assist in the repair or removal of damaged macromolecules. Nrf2 has a crucial role in the maintenance of cellular redox homeostasis by regulating the biosynthesis, utilization, and regeneration of glutathione, thioredoxin, and NADPH and by controlling the production of reactive oxygen species by mitochondria and NADPH oxidase. Under homeostatic conditions, Nrf2 affects the mitochondrial membrane potential, fatty acid oxidation, availability of substrates (NADH and FADH2/succinate) for respiration, and ATP synthesis. Under conditions of stress or growth factor stimulation, activation of Nrf2 counteracts the increased reactive oxygen species production in mitochondria via transcriptional upregulation of uncoupling protein 3 and influences mitochondrial biogenesis by maintaining the levels of nuclear respiratory factor 1 and peroxisome proliferator-activated receptor ? coactivator 1?, as well as by promoting purine nucleotide biosynthesis. Pharmacological Nrf2 activators, such as the naturally occurring isothiocyanate sulforaphane, inhibit oxidant-mediated opening of the mitochondrial permeability transition pore and mitochondrial swelling. Curiously, a synthetic 1,4-diphenyl-1,2,3-triazole compound, originally designed as an Nrf2 activator, was found to promote mitophagy, thereby contributing to the overall mitochondrial homeostasis. Thus, Nrf2 is a prominent player in supporting the structural and functional integrity of the mitochondria, and this role is particularly crucial under conditions of stress.
Nrf2 supports the structural and functional integrity of the mitochondria.
Nrf2 activators have beneficial effects when mitochondrial function is compromised.
Introduction
The transcription factor NF-E2 p45-related factor 2 (Nrf2; gene name NFE2L2) regulates the expression of networks of genes encoding proteins with diverse cytoprotective activities. Nrf2 itself is controlled primarily at the level of protein stability. Under basal conditions, Nrf2 is a short-lived protein that is subjected to continuous ubiquitination and proteasomal degradation. There are three known ubiquitin ligase systems that contribute to the degradation of Nrf2. Historically, the first negative regulator of Nrf2 to be discovered was Kelch-like ECH-associated protein 1 (Keap1) [1], a substrate adaptor protein for Cullin 3 (Cul3)/Rbx1 ubiquitin ligase [2], [3], [4]. Keap1 uses a highly efficient cyclic mechanism to target Nrf2 for ubiquitination and proteasomal degradation, during which Keap1 is continuously regenerated, allowing the cycle to proceed (Fig. 1A) [5]. Nrf2 is also subjected to degradation mediated by glycogen synthase kinase (GSK)3/?-TrCP-dependent Cul1-based ubiquitin ligase [6], [7]. Most recently, it was reported that, during conditions of endoplasmic reticulum stress, Nrf2 is ubiquitinated and degraded in a process mediated by the E3 ubiquitin ligase Hrd1 [8].
Figure 1 The cyclic sequential binding and regeneration model for Keap1-mediated degradation of Nrf2. (A) Nrf2 binds sequentially to a free Keap1 dimer: first through its high-affinity ETGE (red sticks) binding domain and then through its low-affinity DLG (black sticks) binding domain. In this conformation of the protein complex, Nrf2 undergoes ubiquitination and is targeted for proteasomal degradation. Free Keap1 is regenerated and able to bind to newly translated Nrf2, and the cycle begins again.(B) Inducers (white diamonds) react with sensor cysteines of Keap1 (blue sticks), leading to a conformational change and impaired substrate adaptor activity. Free Keap1 is not regenerated, and the newly synthesized Nrf2 accumulates and translocates to the nucleus.
In addition to serving as a ubiquitin ligase substrate adaptor protein, Keap1 is also the sensor for a wide array of small-molecule activators of Nrf2 (termed inducers) [9]. Inducers block the cycle of Keap1-mediated degradation of Nrf2 by chemically modifying specific cysteine residues within Keap1 [10], [11] or by directly disrupting the Keap1:Nrf2 binding interface [12], [13]. Consequently, Nrf2 is not degraded, and the transcription factor accumulates and translocates to the nucleus (Fig. 1B), where it forms a heterodimer with a small Maf protein; binds to antioxidant-response elements, the upstream regulatory regions of its target genes; and initiates transcription [14], [15], [16]. The battery of Nrf2 targets comprises proteins with diverse cytoprotective functions, including enzymes of xenobiotic metabolism, proteins with antioxidant and anti-inflammatory functions, and proteasomal subunits, as well as proteins that regulate cellular redox homeostasis and participate in intermediary metabolism.
Nrf2: a Master Regulator of Cellular Redox Homeostasis
The function of Nrf2 as a master regulator of cellular redox homeostasis is widely recognized. The gene expression of both the catalytic and the regulatory subunits of ?-glutamyl cysteine ligase, the enzyme catalyzing the rate-limiting step in the biosynthesis of reduced glutathione (GSH), is directly regulated by Nrf2 [17]. The xCT subunit of system xc-, which imports cystine into cells, is also a direct transcriptional target of Nrf2 [18]. In the cell, cystine undergoes conversion to cysteine, a precursor for the biosynthesis of GSH. In addition to its role in GSH biosynthesis, Nrf2 provides the means for the maintenance of glutathione in its reduced state by the coordinated transcriptional regulation of glutathione reductase 1 [19], [20], which reduces oxidized glutathione to GSH using reducing equivalents from NADPH. The required NADPH is provided by four principal NADPH-generating enzymes, malic enzyme 1 (ME1), isocitrate dehydrogenase 1 (IDH1), glucose-6-phosphate dehydrogenase (G6PD), and 6-phosphogluconate dehydrogenase (PGD), all of which are transcriptionally regulated in part by Nrf2 (Fig. 2) [21], [22], [23], [24]. Curiously, Nrf2 also regulates the inducible gene expression of the cytosolic, microsomal, and mitochondrial forms of aldehyde dehydrogenase [25], which use NAD(P)+ as a cofactor, giving rise to NAD(P)H. Indeed, the levels of NADPH and the NADPH/NADP+ ratio are lower in embryonic fibroblasts isolated from Nrf2-knockout (Nrf2-KO) mice compared to cells from their wild-type (WT) counterparts, and the NADPH levels decrease upon Nrf2 knockdown in cancer cell lines with constitutively active Nrf2 [26]. As expected, the levels of GSH are lower in cells in which Nrf2 has been disrupted; conversely, Nrf2 activation by genetic or pharmacological means leads to GSH upregulation [27], [28], [29]. Importantly, Nrf2 also regulates the gene expression of thioredoxin [30], [31], [32], thioredoxin reductase 1 [28], [29], [32], [33], and sulfiredoxin [34], which are essential for the reduction of oxidized protein thiols.
Figure 2 The role of Nrf2 in the metabolism of rapidly proliferating cells. Nrf2 is a positive regulator of genes encoding enzymes in both the oxidative arm [i.e., glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD)] and the nonoxidative arm [i.e., transaldolase 1 (TALDO1) and transketolase (TKT)] of the pentose phosphate pathway. G6PD and PGD generate NADPH. Nrf2 also regulates the gene expression of the other two NADPH-generating enzymes, malic enzyme 1 (ME1) and isocitrate dehydrogenase 1 (IDH1). The gene expression of phosphoribosyl pyrophosphate amidotransferase (PPAT), which catalyzes the entry into the de novo purine biosynthetic pathway, is also positively regulated by Nrf2, as is the expression of methylenetetrahydrofolate dehydrogenase 2 (MTHFD2), a mitochondrial enzyme with a critical role in providing one-carbon units for de novo purine biosynthesis. Pyruvate kinase (PK) is negatively regulated by Nrf2 and is expected to favor the buildup of glycolytic intermediates and, together with G6PD, metabolite channeling through the pentose phosphate pathway and the synthesis of nucleic acids, amino acids, and phospholipids. Nrf2 negatively regulates the gene expression of ATP-citrate lyase (CL), which may increase the availability of citrate for mitochondrial utilization or (through isocitrate) for IDH1. Red and blue indicate positive and negative regulation, respectively. The mitochondrion is shown in gray. Metabolite abbreviations: G-6-P, glucose 6-phosphate; F-6-P, fructose 6-phosphate; F-1,6-BP, fructose 1,6-bisphosphate; GA-3-P, glyceraldehyde 3-phosphate; 3-PG, 3-phosphoglycerate; PEP, phosphoenolpyruvate; 6-P-Gl, 6-phosphogluconolactone; 6-PG, 6-phosphogluconate; R-5-P, ribulose 5-phosphate; PRPP, 5-phosphoribosyl-?-1-pyrophosphate; THF, tetrahydrofolate; IMP, inosine monophosphate; AMP, adenosine monophosphate; GMP, guanosine monophosphate.
Given the crucial role of Nrf2 as a master regulator of cellular redox homeostasis, it is not surprising that, compared to WT cells, the levels of reactive oxygen species (ROS) are higher in cells in which Nrf2 has been disrupted (Nrf2-KO) [35]. This difference is particularly striking upon challenge with agents causing oxidative stress. Moreover, cells deficient in Nrf2 are much more sensitive to the toxicity of oxidants of various types and cannot be protected by Nrf2 inducers, which, under the same conditions, provide efficient and long-lasting protection to WT cells [29], [36], [37]. In addition to the overall cellular redox homeostasis, Nrf2 is also critical for the maintenance of the mitochondrial redox homeostasis. Thus, compared to WT, the total mitochondrial NADH pool is significantly increased in Keap1-KO and dramatically decreased in Nrf2-KO cells [35].
Using live cell imaging, we recently monitored the rates of ROS production in primary glioneuronal cocultures and brain tissue slices isolated from WT, Nrf2-KO, or Keap1-knockdown (Keap1-KD) mice [38]. As expected, the rate of ROS production was faster in Nrf2-KO cells and tissues compared to their WT counterparts. However, we made the unexpected observation that, compared to WT, Keap1-KD cells also have higher rates of ROS production, although the magnitude of the difference between the WT and the Keap1-KD genotypes was smaller than that between WT and Nrf2-KO. We then analyzed the mRNA levels of NOX2 and NOX4, the catalytic subunits of the two NADPH oxidase (NOX) isoforms that have been implicated in brain pathology, and found that NOX2 is dramatically increased under conditions of Nrf2 deficiency, whereas NOX4 is upregulated when Nrf2 is constitutively activated, although to a smaller extent. Quantitatively, the magnitude of upregulation in cells and tissues from the mutant mice parallels the corresponding increases in ROS production [38]. Interestingly, not only does Nrf2 regulate NADPH oxidase, but the ROS produced by NADPH oxidase can activate Nrf2, as shown in pulmonary epithelial cells and cardiomyocytes [39], [40]. Furthermore, a very recent study has demonstrated that the NADPH oxidase-dependent activation of Nrf2 constitutes an important endogenous mechanism for protection against mitochondrial damage and cell death in the heart during chronic pressure overload [41].
In addition to the catalytic activity of NADPH oxidase, mitochondrial respiration is another major intracellular source of ROS.By use of the mitochondria-specific probe MitoSOX, we have examined the contribution of ROS of mitochondrial origin to the overall ROS production in primary glioneuronal cocultures isolated from WT, Nrf2-KO, or Keap1-KD mice [38]. As expected, Nrf2-KO cells had higher rates of mitochondrial ROS production than WT. In agreement with the findings for the overall ROS production, the rates of mitochondrial ROS production in Keap1-KD were also higher compared to WT cells. Importantly, blocking complex I with rotenone caused a dramatic increase in mitochondrial ROS production in both WT and Keap1-KD cells, but had no effect in Nrf2-KO cells. In contrast to the expected increase in mitochondrial ROS production in WT cells after addition of pyruvate (to enhance the availability of NADH, increase the mitochondrial membrane potential,and normalize respiration), the production of ROS decreased in Nrf2-KO cells. Together, these findings strongly suggest that, in the absence of Nrf2: (i) the activity of complex I is impaired, (ii) the impaired activity of complex I is due to limitation of substrates, and (iii) the impaired activity of complex I is one of the main reasons for the increased mitochondrial ROS production, possibly owing to reverse electron flow from complex II.
Nrf2 Affects Mitochondrial Membrane Potential and Respiration
The mitochondrial membrane potential (??m) is a universal indicator of mitochondrial health and the metabolic state of the cell. In a healthy cell, ??m is maintained by the mitochondrial respiratory chain. Interestingly, a stable isotopic labeling with amino acids in culture-based proteomics study in the estrogen receptor-negative nontumorigenic human breast epithelial MCF10A cell line has shown that the mitochondrial electron transport chain component NDUFA4 is upregulated by pharmacological activation (by sulforaphane) of Nrf2, whereas genetic upregulation of Nrf2 (by Keap1 knockdown) leads to downregulation of the cytochrome c oxidase subunits COX2 and COX4I1 [42]. A study of the liver proteome using two-dimensional gel electrophoresis and matrix-assisted laser desorption/ionization mass spectrometry has found that Nrf2 regulates the expression of ATP synthase subunit ? [43]. In addition, the mitochondrial protein DJ-1, which plays a role in the maintenance of the activity of complex I [44], has been reported to stabilize Nrf2 [45], [46], although the neuroprotective effects of pharmacological or genetic activation of Nrf2 are independent of DJ-1 [47]. However, the consequences of these observations for mitochondrial function have not been investigated.
In agreement with the impaired activity of complex I under conditions of Nrf2 deficiency, the basal ??m is lower in Nrf2-KO mouse embryonic fibroblasts (MEFs) and cultured primary glioneuronal cells in comparison with their WT counterparts (Fig. 3,inset) [35]. In contrast, the basal ??m is higher when Nrf2 is genetically constitutively upregulated (by knockdown or knockout of Keap1). These differences in ??m among the genotypes indicate that respiration is affected by the activity of Nrf2. Indeed, evaluation of the oxygen consumption in the basal state has revealed that, compared to WT, the oxygen consumption is lower in Nrf2-KO and Keap1-KO MEFs, by ~50 and ~35%, respectively.
Figure 3 Proposed mechanism for compromised mitochondrial function under conditions of Nrf2 deficiency. (1) The decreased levels of ME1, IDH1, G6PD, and PGD result in lower NADPH levels. (2) The levels of GSH are also low. (3) The low activity of ME1 may decrease the pool of pyruvate entering the mitochondria. (4) The generation of NADH is slower, leading to impaired activity of complex I and increased mitochondrial ROS production. (5) The reduction of FAD to FADH2 in mitochondrial proteins is also decreased, lowering the electron flow from FADH2 to UbQ and into complex III. (6) The slower formation of UbQH2 may lower the enzyme activity of succinate dehydrogenase. (7) The increased levels of ROS may further inhibit the activity of complex II. (8) The lower efficiency of fatty acid oxidation contributes to the decreased substrate availability for mitochondrial respiration. (9) Glycolysis is enhanced as a compensatory mechanism for the decreased ATP production in oxidative phosphorylation. (10) ATP synthase operates in reverse to maintain ??m. Red and blue indicate upregulation and downregulation, respectively. The boxes signify availability of experimental evidence. The inset shows images of mitochondria of WT and Nrf2-KO cortical astrocytes visualized by the potentiometric fluorescent probe tetramethylrhodamine methyl ester (TMRM; 25 nM). Scale bar, 20 �m.
These differences in ??m and respiration among the genotypes are reflected by the rate of utilization of substrates for mitochondrial respiration. Application of substrates for the tricarboxylic acid (TCA) cycle (malate/pyruvate, which in turn increase the production of the complex I substrate NADH) or methyl succinate, a substrate for complex II, causes a stepwise increase in ??m in both WT and Keap1-KD neurons, but the rate of increase is higher in Keap1-KD cells. More importantly, the shapes of the response to these TCA cycle substrates are different between the two genotypes, whereby the rapid rise in ??m in Keap1-KD cells upon substrate addition is followed by a quick drop rather than a plateau, suggesting an unusually fast substrate consumption. These findings are in close agreement with the much lower (by 50�70%) levels of malate, pyruvate, and succinate that have been observed after a 1-h pulse of [U-13C6]glucose in Keap1-KO compared to WT MEF cells [24]. In Nrf2-KO neurons, only pyruvate is able to increase the ??m, whereas malate and methyl succinate cause mild depolarization. The effect of Nrf2 on mitochondrial substrate production seems to be the main mechanism by which Nrf2 affects mitochondrial function. The mitochondrial NADH redox index (the balance between consumption of NADH by complex I and production of NADPH in the TCA cycle) is significantly lower in Nrf2-KO cells in comparison with their WT counterparts, and furthermore, the rates of regeneration of the pools of NADH and FADH2 after inhibition of complex IV (by use of NaCN) are slower in the mutant cells.
In mitochondria isolated from murine brain and liver, supplementation of substrates for complex I or for complex II increases the rate of oxygen consumption more strongly when Nrf2 is activated and less efficiently when Nrf2 is disrupted [35]. Thus, malate induces a higher rate of oxygen consumption in Keap1-KD compared to WT, but its effect is weaker in Nrf2-KO mitochondria. Similarly, in the presence of rotenone (when complex I is inhibited), succinate activates oxygen consumption to a greater extent in Keap1-KD compared to WT, whereas the response in Nrf2-KO mitochondria is diminished. In addition, Nrf2-KO primary neuronal cultures and mice are more sensitive to the toxicity of the complex II inhibitors 3-nitropropionic acid and malonate, whereas intrastriatal transplantation of Nrf2-overexpressing astrocytes is protective [48], [49]. Similarly, Nrf2-KO mice are more sensitive to, whereas genetic or pharmacological activation of Nrf2 has protective effects against, neurotoxicity caused by the complex I inhibitor 1-methyl-4-phenylpyridinium ion in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine animal model of Parkinson?s disease [49], [50], [51], [52], [53], [54], [55], [56], [57], [58], [59], [60], [61].
The respiratory control ratio (RCR), the ratio of State 3 (ADP-stimulated) to State 4 respiration (no ADP present), is decreased in the absence of Nrf2, but the RCR is similar between Keap1-KD and WT mitochondria [35]. As the RCR is an indication of the degree of coupling of the mitochondrial respiratory chain activity to oxidative phosphorylation, this finding indicates that the higher rate of respiration in Keap1-KD mitochondria is not due to uncoupling of oxidative phosphorylation. It further suggests that oxidative phosphorylation is more efficient when Nrf2 is activated. The higher rate of respiration in Keap1-KD mitochondria is consistent with the higher levels of mitochondrial ROS production [38] as higher respiration rates may lead to increased electron leak. However, under conditions of oxidative stress, the increased ROS production is counteracted by the Nrf2-dependent transcriptional upregulation of uncoupling protein 3 (UCP3), which increases the proton conductance of the mitochondrial inner membrane and consequently decreases the production of superoxide [62]. Very recently, it was shown that the lipid peroxidation product 4-hydroxy-2-nonenal mediates the Nrf2-dependent upregulation of UCP3 in cardiomyocytes; this might be particularly important for protection under conditions of oxidative stress such as those during ischemia�reperfusion [63].
Nrf2 Affects the Efficiency of Oxidative Phosphorylation and the Synthesis of ATP
In agreement with the effect of Nrf2 on respiration, in brain and liver mitochondria, Nrf2 deficiency results in a decreased efficiency of oxidative phosphorylation (as estimated by the ratio of ADP to oxygen, which is consumed for ATP synthesis), whereas Nrf2 activation (Keap1-KD) has the opposite effect [35]. Compared to WT, the ATP levels are significantly higher in cells with constitutive upregulation of Nrf2 and lower when Nrf2 is knocked down [64] or disrupted [35]. Furthermore, the use of inhibitors of oxidative phosphorylation (oligomycin) or glycolysis (iodoacetic acid) has revealed that Nrf2 changes the way by which cells produce ATP. Thus, in WT neurons, oligomycin causes a complete drop in ATP and iodoacetic acid has no further effect. Remarkably, in Nrf2-KO cells, oligomycin increases the ATP levels, which are then slowly, but completely, depleted by iodoacetic acid, indicating that in the absence of Nrf2, glycolysis, and not oxidative phosphorylation, is the main source of ATP production. Interestingly, despite the increased efficiency of oxidative phosphorylation in Keap1-KD cells, addition of oligomycin results in an ~80% decrease in ATP levels, and iodoacetic acid causes a further ~20% decrease. Thus, either Nrf2 deficiency or its constitutive activation reduces the contribution of oxidative phosphorylation and increases the contribution of glycolysis toward the synthesis of ATP. This effect is particularly pronounced when Nrf2 is absent and is consistent with the dependence of the ??m on the presence of glucose in the medium [35] and the increased levels of glycolytic intermediates (G-6-P, F-6-P, dihydroxyacetone phosphate, pyruvate, and lactate) after knockdown of Nrf2 [24].
The increase in ATP levels after inhibition of the F1F0-ATPase by oligomycin indicates that in the absence of Nrf2, the F1F0-ATPase functions as an ATPase and not an ATP synthase, i.e., it operates in reverse. Such reversal in activity most likely reflects the need to pump protons across the inner mitochondrial membrane in an attempt to maintain the ??m, which is crucial for the functional integrity of this organelle. The reversal of the function of the F1F0-ATPase is also evidenced by the observed mitochondrial depolarization upon oligomycin administration to Nrf2-KO cells, which is in sharp contrast to the hyperpolarization occurring in their WT or Keap1-deficient counterparts [35]. Overall, it seems that under conditions of Nrf2 deficiency ATP is produced primarily in glycolysis, and this ATP is then used in part by the F1F0-ATPase to maintain the ??m.
Nrf2 Enhances Mitochondrial Fatty Acid Oxidation
The effect of Nrf2 deficiency on the ??m is particularly pronounced when cells are incubated in medium without glucose, and the ??m is ~50% lower in Nrf2-KO compared to WT cells [35]. Under conditions of glucose deprivation, mitochondrial fatty acid oxidation (FAO) is a major provider of substrates for respiration and oxidative phosphorylation, suggesting that Nrf2 may affect FAO. Indeed, the efficiency of FAO for both the long-chain (C16:0) saturated fatty acid palmitic acid and the short-chain (C6:0) hexanoic acid is higher in Keap1-KO MEFs and isolated heart and liver mitochondria than in their WT counterparts, whereas it is lower in Nrf2-KO cells and mitochondria [65]. These effects are also highly relevant to humans: indeed, metabolic changes indicative of better integration of FAO with the activity of the TCA cycle have been reported to occur in human intervention studies with diets rich in glucoraphanin, the precursor of the classical Nrf2 activator sulforaphane [66].
During the first step of mitochondrial FAO, the pro-R hydrogen of the ?-carbon leaves as a hydride that reduces the FAD cofactor to FADH2, which in turn transfers electrons to ubiquinone (UbQ) in the respiratory chain, ultimately contributing to ATP production. Whereas stimulation of FAO by palmitoylcarnitine in the absence of glucose causes the expected increase in the ATP levels in WT and Keap1-KO cells, with the ATP rise being faster in Keap1-KO cells, the identical treatment produces no ATP changes in Nrf2-KO MEFs [65]. This experiment demonstrates that, in the absence of Nrf2, FAO is suppressed, and furthermore, it implicates suppression of FAO as one of the reasons for the lower ATP levels under conditions of Nrf2 deficiency [35], [64].
Notably, human 293 T cells in which Nrf2 has been silenced have a lower expression of CPT1 and CPT2[67], two isoforms of carnitine palmitoyltransferase (CPT), the rate-limiting enzyme in mitochondrial FAO. In agreement, the mRNA levels of Cpt1 are lower in livers of Nrf2-KO compared to WT mice [68]. CPT catalyzes the transfer of the acyl group of a long-chain fatty acyl-CoA from coenzyme A to l-carnitine and thus permits the import of acylcarnitine from the cytoplasm into the mitochondria. Although this has not been examined to date, it is possible that in addition to the transcriptional effects on CPT1 expression, Nrf2 may also affect the function of this enzyme by controlling the levels of its main allosteric inhibitor, malonyl-CoA. This is because, by a mechanism that is currently unclear, Nrf2 regulates negatively the expression of stearoyl CoA desaturase (SCD) [69] and citrate lyase (CL) [69], [70]. Curiously, knockout or inhibition of SCD leads to increased phosphorylation and activation of AMP-activated protein kinase (AMPK) [71], [72], [73], and it can be speculated that, in the absence of Nrf2, the SCD levels will increase, in turn lowering AMPK activity. This could be further compounded by the reduced protein levels of AMPK that have been observed in livers of Nrf2-KO mice [68], a finding that is in close agreement with the increased AMPK levels, which have been reported in livers of Keap1-KD mice [74]. One consequence of the decreased AMPK activity is the relief of its inhibitory phosphorylation (at Ser79) of acetyl-CoA carboxylase (ACC) [75], which could be further transcriptionally upregulated in the absence of Nrf2 because it is downregulated by Nrf2 activation [70]. The high ACC activity, in combination with the upregulated CL expression that will increase the production of acetyl-CoA, the substrate for ACC, may ultimately increase the levels of the ACC product, malonyl-CoA. The high levels of malonyl-CoA will inhibit CPT, thereby decreasing the transport of fatty acids into the mitochondria. Finally, Nrf2 positively regulates the expression of CD36 [76], a translocase that imports fatty acids across plasma and mitochondrial membranes. Thus, one mechanism by which Nrf2 may affect the efficiency of mitochondrial FAO is by regulating the import of long-chain fatty acids into the mitochondria.
In addition to direct transcriptional regulation, Nrf2 may also alter the efficiency of mitochondrial FAO by its effects on the cellular redox metabolism. This may be especially relevant when Nrf2 activity is low or absent, conditions that shift the cellular redox status toward the oxidized state. Indeed, several FAO enzymes have been identified as being sensitive to redox changes. One such enzyme is very long-chain acyl-CoA dehydrogenase (VLCAD), which contributes more than 80% to the palmitoyl-CoA dehydrogenation activity in human tissues [77]. Interestingly, Hurd et al. [78] have shown that VLCAD contains cysteine residues that significantly change their redox state upon exposure of isolated rat heart mitochondria to H2O2. Additionally, S-nitrosylation of murine hepatic VLCAD at Cys238 improves the catalytic efficiency of the enzyme [79], and it is likely that oxidation of the same cysteine may have the opposite effect, ultimately lowering the efficiency of mitochondrial FAO. It is therefore possible that, although the expression levels of VLCAD are not significantly different in WT, Nrf2-KO, or Keap1-KO MEFs [65], the enzyme activity of VLCAD could be lower in the absence of Nrf2 owing to the higher levels of ROS.
Based on all of these findings, it can be proposed that (Fig. 3): in the absence of Nrf2, the NADPH levels are lower owing to decreased expression of ME1, IDH1, G6PD, and PGD. The levels of reduced glutathione are also lower owing to decreased expression of enzymes that participate in its biosynthesis and regeneration and the lower levels of NADPH that are required for the conversion of the oxidized to the reduced form of glutathione. The low expression of ME1 will decrease the pool of pyruvate entering the mitochondria, with glycolysis becoming the major source of pyruvate. The generation of NADH is slower, leading to impaired activity of complex I and increased mitochondrial ROS production. The reduction of FAD to FADH2 is also slower, at least in part owing to less efficient fatty acid oxidation, compromising the electron flow from FADH2 to UbQ and into complex III. As UbQH2 is an activator of succinate dehydrogenase [80], slowing down its formation may lower the enzyme activity of succinate dehydrogenase. The increased levels of superoxide and hydrogen peroxide can inhibit complex II activity further [81]. The lower efficiency of fatty acid oxidation contributes to the decreased substrate availability for mitochondrial respiration and ATP production in oxidative phosphorylation. As a compensatory mechanism, glycolysis is enhanced. ATP synthase functions in reverse, as an ATPase, in an attempt to maintain the ??m.
Nrf2 and Mitochondrial Biogenesis
It has been reported that, compared to WT, the livers of Nrf2-KO mice have a lower mitochondrial content (as determined by the ratio of mitochondrial to nuclear DNA); this is further decreased by a 24-h fast in both WT and Nrf2-KO mice; in contrast, although no different from WT under normal feeding conditions, the mitochondrial content in mice with high Nrf2 activity is not affected by fasting [82]. Interestingly, supplementation with the Nrf2 activator (R)-?-lipoic acid [83], [84], [85] promotes mitochondrial biogenesis in 3T3-L1 adipocytes [86]. Two classes of nuclear transcriptional regulators play critical roles in mitochondrial biogenesis. The first class are transcription factors, such as nuclear respiratory factors11 and 2, which control the expression of genes encoding subunits of the five respiratory complexes, mitochondrial translational components, and heme biosynthetic enzymes that are localized to the mitochondrial matrix [88]. Piantadosi et al. [89] have shown that the Nrf2-dependent transcriptional upregulation of nuclear respiratory factor 1 promotes mitochondrial biogenesis and protects against the cytotoxicity of the cardiotoxic anthracycline chemotherapeutic agent doxorubicin. In contrast, Zhang et al. [82] have reported that genetic activation of Nrf2 does not affect the basal mRNA expression of nuclear respiratory factor 1 in the murine liver.
The second class of nuclear transcriptional regulators with critical functions in mitochondrial biogenesis are transcriptional coactivators, such as peroxisome proliferator-activated receptor ? coactivators (PGC)1? and 1?, which interact with transcription factors, the basal transcriptional and RNA-splicing machinery, and histone-modifying enzymes [88], [90], [91]. The expression of the PGC1 family of coactivators is influenced by numerous environmental signals. Treatment of human fibroblasts with the Nrf2 activator sulforaphane causes an increase in mitochondrial mass and induction of PGC1? and PGC1? [92], although the potential dependence on Nrf2 was not examined in this study. However, diabetic mice in which Nrf2 is either activated by Keap1 gene hypomorphic knockdown (db/db:Keap1flox/?:Nrf2+/+) or disrupted (db/db:Keap1flox/?:Nrf2?/?) have lower hepatic PGC1? expression levels than control animals (db/db:Keap1flox/+:Nrf2+/+) [93]. No differences in the mRNA levels for PGC1? are seen in livers of nondiabetic mice that are either WT or Nrf2-KO, whereas these levels are lower in Nrf2-overexpressing (Keap1-KD and liver-specific Keap1-KO) animals [82]. Notably, a 24-h fast increases the levels of PGC1? mRNA in the livers of mice of all genotypes, but the increase is significantly greater in livers of Nrf2-KO compared to WT or Nrf2-overexpressing mice. Compared to WT, Nrf2-KO mice experiencing septic infection or acute lung injury due to infection show attenuated transcriptional upregulation of nuclear respiratory factor 1 and PGC1? [94], [95]. Together, these observations suggest that the role of Nrf2 in maintaining the levels of both nuclear respiratory factor 1 and PGC1? is complex and becomes most prominent under conditions of stress.
In addition to expression of genes encoding mitochondrial proteins, mitochondrial biogenesis requires the synthesis of nucleotides. Genetic activation of Nrf2 enhances purine biosynthesis by upregulating the pentose phosphate pathway and the metabolism of folate and glutamine, particularly in rapidly proliferating cells (Fig. 2) [24]. Analysis of the transcriptome of mutant Drosophila deficient for the mitochondrial serine/threonine protein kinase PTEN-induced putative kinase 1 (PINK1) has shown that mitochondrial dysfunction leads to the transcriptional upregulation of genes affecting nucleotide metabolism [96], suggesting that the enhanced nucleotide biosynthesis represents a mechanism for protection against the neurotoxic consequences of PINK1 deficiency. Nrf2 regulates the expression of phosphoribosyl pyrophosphate amidotransferase (PPAT), which catalyzes the entry into the de novo purine nucleotide biosynthetic pathway, and mitochondrial methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) (Fig. 2). The latter is a bifunctional enzyme with dehydrogenase and cyclohydrolase activities that is critical in providing both glycine and formate as sources of one-carbon units for purine biosynthesis in rapidly growing cells [97]. It is therefore likely that Nrf2 activation might be protective and might reverse mitochondrial dysfunction in PINK1 deficiency. Indeed, pharmacological activation of Nrf2 by sulforaphane, or the triterpenoid RTA-408, restores ??m and protects PINK1-deficient cells against dopamine toxicity [98]. Although the underlying mechanisms seem to be complex, together, these findings indicate that Nrf2 activity may affect mitochondrial biogenesis by influencing the expression levels of critical transcription factors and coactivators, as well as by enhancing nucleotide biosynthesis.
Nrf2 and Mitochondrial Integrity
Although direct evidence is not always available, there are strong indications that Nrf2 is important for mitochondrial integrity, particularly under conditions of oxidative stress. Mitochondria isolated from the brain and liver of rats that had been administered a single dose of the Nrf2 activator sulforaphane are resistant to opening of the mitochondrial permeability transition pore (mPTP) caused by the oxidant tert-butylhydroperoxide [99], [100]. The mPTP, a complex that allows the mitochondrial inner membrane to become permeable to molecules with masses up to 1500 Da, was recently identified to be formed from dimers of the F0F1-ATP synthase [101]. The sulforaphane-mediated resistance to mPTP opening correlates with increased antioxidant defenses, and the levels of mitochondrial GSH, glutathione peroxidase 1, malic enzyme 3, and thioredoxin 2 are all upregulated in mitochondrial fractions isolated from sulforaphane-treated animals [100].
Mitochondrial protein damage and impairment in respiration caused by the electrophilic lipid peroxidation product 4-hydroxy-2-nonenal are attenuated in mitochondria isolated from the cerebral cortex of sulforaphane-treated mice [102]. In rat renal epithelial cells and in kidney, sulforaphane is protective against cisplatin- and gentamicin-induced toxicity and loss of ??m[103], [104]. Protection against a panel of oxidants (superoxide, hydrogen peroxide, peroxynitrite) and electrophiles (4-hydroxy-2-nonenal and acrolein) and an increase in mitochondrial antioxidant defenses have been also observed upon treatment of rat aortic smooth muscle cells with sulforaphane [105]. In a model of contrast-induced acute kidney injury, limb ischemic preconditioning was recently shown to have protective effects, including inhibition of the opening of the mPTP and mitochondrial swelling, by activation of Nrf2 consequent to the inhibition of GSK3? [106].
Mitophagy, the process by which dysfunctional mitochondria are selectively engulfed by autophagosomes and delivered to lysosomes to be degraded and recycled by the cell, is essential for mitochondrial homeostasis [107], [108]. Whereas no causative relation between Nrf2 and mitophagy has been established, there is evidence that the transcription factor may be important in mitochondrial quality control by playing a role in mitophagy. This might be especially prominent under conditions of oxidative stress. Thus, in a model of sepsis, the increases in the levels of the autophagosome marker MAP1 light chain 3-II (LC3-II) and the cargo protein p62 at 24 h postinfection are suppressed in Nrf2-KO compared to WT mice [109]. A small-molecule inducer of mitophagy (called p62-mediated mitophagy inducer, PMI) was recently discovered; this 1,4-diphenyl-1,2,3-triazole compound was originally designed as an Nrf2 activator that disrupts the interaction of the transcription factor with Keap1 [110]. Similar to cells in which Nrf2 is genetically upregulated (Keap1-KD or Keap1-KO), cells exposed to PMI have higher resting ??m. Importantly, the increase in mitochondrial LC3 localization that is observed after PMI treatment of WT cells does not occur in Nrf2-KO cells, suggesting the involvement of Nrf2.
Last, ultrastructural analysis of liver sections has revealed the presence of swollen mitochondria with reduced crista and disrupted membranes in hepatocytes of Nrf2-KO, but not WT, mice that had been fed a high-fat diet for 24 weeks; notably, these livers show clear evidence of oxidative stress and inflammation [68]. It can be concluded that Nrf2 has a critical role in maintaining mitochondrial integrity under conditions of oxidative and inflammatory stress.
Sulforaphane and Its Effects on Cancer, Mortality, Aging, Brain and Behavior, Heart Disease & More
Isothiocyanates are some of the most important plant compounds you can get in your diet. In this video I make the most comprehensive case for them that has ever been made. Short attention span? Skip to your favorite topic by clicking one of the time points below. Full timeline below.
Key sections:
00:01:14 – Cancer and mortality
00:19:04 – Aging
00:26:30 – Brain and behavior
00:38:06 – Final recap
00:40:27 – Dose
Full timeline:
00:00:34 – Introduction of sulforaphane, a major focus of the video.
00:01:14 – Cruciferous vegetable consumption and reductions in all-cause mortality.
00:02:12 – Prostate cancer risk.
00:02:23 – Bladder cancer risk.
00:02:34 – Lung cancer in smokers risk.
00:02:48 – Breast cancer risk.
00:03:13 – Hypothetical: what if you already have cancer? (interventional)
00:03:35 – Plausible mechanism driving the cancer and mortality associative data.
00:04:38 – Sulforaphane and cancer.
00:05:32 – Animal evidence showing strong effect of broccoli sprout extract on bladder tumor development in rats.
00:06:06 – Effect of direct supplementation of sulforaphane in prostate cancer patients.
00:07:09 – Bioaccumulation of isothiocyanate metabolites in actual breast tissue.
00:08:32 – Inhibition of breast cancer stem cells.
00:08:53 – History lesson: brassicas were established as having health properties even in ancient Rome.
00:09:16 – Sulforaphane’s ability to enhance carcinogen excretion (benzene, acrolein).
00:09:51 – NRF2 as a genetic switch via antioxidant response elements.
00:10:10 – How NRF2 activation enhances carcinogen excretion via glutathione-S-conjugates.
00:10:34 – Brussels sprouts increase glutathione-S-transferase and reduce DNA damage.
00:11:20 – Broccoli sprout drink increases benzene excretion by 61%.
00:13:31 – Broccoli sprout homogenate increases antioxidant enzymes in the upper airway.
00:15:45 – Cruciferous vegetable consumption and heart disease mortality.
00:16:55 – Broccoli sprout powder improves blood lipids and overall heart disease risk in type 2 diabetics.
00:19:04 – Beginning of aging section.
00:19:21 – Sulforaphane-enriched diet enhances lifespan of beetles from 15 to 30% (in certain conditions).
00:20:34 – Importance of low inflammation for longevity.
00:22:05 – Cruciferous vegetables and broccoli sprout powder seem to reduce a wide variety of inflammatory markers in humans.
00:36:32 – Sulforaphane improves learning in model of type II diabetes in mice.
00:37:19 – Sulforaphane and duchenne muscular dystrophy.
00:37:44 – Myostatin inhibition in muscle satellite cells (in vitro).
00:38:06 – Late-video recap: mortality and cancer, DNA damage, oxidative stress and inflammation, benzene excretion, cardiovascular disease, type II diabetes, effects on the brain (depression, autism, schizophrenia, neurodegeneration), NRF2 pathway.
00:40:27 – Thoughts on figuring out a dose of broccoli sprouts or sulforaphane.
00:41:01 – Anecdotes on sprouting at home.
00:43:14 – On cooking temperatures and sulforaphane activity.
00:43:45 – Gut bacteria conversion of sulforaphane from glucoraphanin.
00:44:24 – Supplements work better when combined with active myrosinase from vegetables.
00:44:56 – Cooking techniques and cruciferous vegetables.
00:46:06 – Isothiocyanates as goitrogens.
Nrf2 is a transcription factor which plays an important role in the cellular antioxidant defense system of the human body. The antioxidant responsive element, or ARE, is a regulatory mechanism of genes. Many research studies have demonstrated that Nrf2, or NF-E2-related factor 2, regulates a wide variety of ARE-driven genes throughout several types of cells. Nrf2 was also found to play an essential role in cellular protection and anti-carcinogenicity, which demonstrates that Nrf2 may be an effective treatment in the management of neurodegenerative diseases and cancers believed to be caused by oxidative stress. Dr. Alex Jimenez D.C., C.C.S.T. Insight
Concluding Remarks
Although many questions still remain open, the available experimental evidence clearly indicates that Nrf2 is an important player in the maintenance of mitochondrial homeostasis and structural integrity. This role becomes particularly critical under conditions of oxidative, electrophilic, and inflammatory stress when the ability to upregulate Nrf2-mediated cytoprotective responses influences the overall health and survival of the cell and the organism. The role of Nrf2 in mitochondrial function represents another layer of the broad cytoprotective mechanisms orchestrated by this transcription factor. As many human pathological conditions have oxidative stress, inflammation, and mitochondrial dysfunction as essential components of their pathogenesis, pharmacological activation of Nrf2 holds promise for disease prevention and treatment. Comprehensive understanding of the precise mechanisms by which Nrf2 affects mitochondrial function is essential for rational design of future clinical trials and may offer new biomarkers for monitoring therapeutic efficacy.
The purpose of the article above was to discuss�as well as demonstrate�the emerging role of Nrf2 in mitochondrial function. Nrf2, or nuclear factor erythroid 2-related factor, is an emerging regulator of cellular resistance to oxidants which can contribute to oxidative stress, affecting cellular function and leading to the development of toxicity, chronic disease, and even cancer. While the production of oxidants in the human body can serve�various purposes,�including cell division, inflammation, immune function, autophagy, and stress response, it’s essential to control their overproduction to prevent health issues. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Back pain�is one of the most prevalent causes of disability and missed days at work worldwide. Back pain attributes to the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments, and muscles, among other soft tissues. Because of this, injuries and/or aggravated conditions, such as�herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief. �
Nrf2 supports the activation of a group of antioxidant and detoxifying enzymes and genes which protect the human body from the effects of health issues associated with increased levels of oxidative stress, such as Alzheimer’s disease. A variety of natural substances have been demonstrated to activate the Nrf2 pathway, which can help manage the symptoms of neurodegenerative diseases. The purpose of the article below is to discuss the pivotal role of Nrf2 caused by chronic inflammation.
Abstract
Inflammation is the most common feature of many chronic diseases and complications, while playing critical roles in carcinogenesis. Several studies have demonstrated that Nrf2 contributes to the anti-inflammatory process by orchestrating the recruitment of inflammatory cells and regulating gene expression through the antioxidant response element (ARE). The Keap1 (Kelch-like ECH-associated protein)/Nrf2 (NF-E2 p45-related factor 2)/ARE signaling pathway mainly regulates anti-inflammatory gene expression and inhibits the progression of inflammation. Therefore, the identification of new Nrf2-dependent anti-inflammatory phytochemicals has become a key point in drug discovery. In this review, we discuss the members of the Keap1/Nrf2/ARE signal pathway and its downstream genes, the effects of this pathway on animal models of inflammatory diseases, and crosstalk with the NF-?B pathway. In addition we also discuss about the regulation of NLRP3 inflammasome by Nrf2. Besides this, we summarize the current scenario of the development of anti-inflammatory phytochemicals and others that mediate the Nrf2/ARE signaling pathway.
Inflammation is a complex process that occurs when tissues are infected or injured by harmful stimuli such as pathogens, damage, or irritants. Immune cells, blood vessels, and molecular mediators are involved in this protective response [1]. Inflammation is also a pathological phenomenon associated with a variety of disease states induced mainly by physical, chemical, biological, and psychological factors. The aim of inflammation is to limit and eliminate the causes of cellular damage, clear and/or absorb necrotic cells and tissues, and initiate tissue repair. Two distinct forms of inflammation are distinguished: acute and chronic. Acute inflammation is self-limiting and beneficial to the host, but prolonged chronic inflammation is a common feature of many chronic diseases and complications. Direct infiltration by many mononuclear immune cells such as monocytes, macrophages, lymphocytes, and plasma cells, as well as the production of inflammatory cytokines, lead to chronic inflammation. It is recognized that chronic inflammation plays a critical role in carcinogenesis [2]. In general, both pro- and anti-inflammatory signaling pathways interact in the normal inflammatory process.
In the pathological inflammatory process, mast cells, monocytes, macrophages, lymphocytes, and other immune cells are first activated. Then the cells are recruited to the site of injury, resulting in the generation of reactive oxygen species (ROS) that damage macromolecules including DNA. At the same time, these inflammatory cells also produce large amounts of inflammatory mediators such as cytokines, chemokines, and prostaglandins. These mediators further recruit macrophages to localized sites of inflammation and directly activate multiple signal transduction cascades and transcription factors associated with inflammation. The NF-?B (nuclear factor kappa B), MAPK (mitogen-activated protein kinase), and JAK (janus kinase)-STAT (signal transducers and activators of transcription) signaling pathways are involved in the development of the classical pathway of inflammation [3], [4], [5]. Previous studies have revealed that the transcription factor Nrf2 (NF-E2 p45-related factor 2) regulates the expression of phase II detoxifying enzymes including NADPH, NAD(P)H quinone oxidoreductase 1, glutathione peroxidase, ferritin, heme oxygenase-1 (HO-1), and antioxidant genes that protect cells from various injuries via their anti-inflammatory effects, thus influencing the course of disease [6], [7], [8].
Considering these remarkable findings, the development of targeted therapeutic drugs for inflammatory diseases via signaling pathways has attracted much interest in recent years. In this review, we summarize research on the Keap1 (Kelch-like ECH associated protein)/Nrf2 (NF-E2 p45-related factor 2)/ARE (antioxidant response element) signaling pathway in inflammation.
Structure and Regulation of Nrf2
Keap1-Dependent Nrf2 Regulation
Nrf2 belongs to the Cap �n� Collar (CNC) subfamily and comprises in seven functional domains, Neh (Nrf2-ECH homology) 1 to Neh7 [9], [10]. Neh1 is a CNC-bZIP domain that allows Nrf2 to heterodimerize with small musculoaponeurotic fibrosarcoma (Maf) protein, DNA, and other transcription partners as well as forming a nuclear complex with the ubiquitin-conjugating enzyme UbcM2 [11], [12]. Neh2 contains two important motifs known as DLG and ETGE, which are essential for the interaction between Nrf2 and its negative regulator Keap1 [13], [14].
Keap1 is a substrate adaptor for cullin-based E3 ubiquitin ligase, which inhibits the transcriptional activity of Nrf2 via ubiquitination and proteasomal degradation under normal conditions [15], [16], [17]. The KELCH domains of the Keap1 homodimer bind with the DLG and ETGE motifs of the Nrf2-Neh2 domain in the cytosol, where ETGE acts as a hinge with higher affinity and DLG acts as a latch [18]. Under oxidative stress or upon exposure to Nrf2 activators, Nrf2 dissociates from Keap1 binding due to the thiol modification of Keap1 cysteine residues which ultimately prevents Nrf2 ubiquitination and proteasomal degradation [19]. Then Nrf2 translocates into the nucleus, heterodimerizes with small Maf proteins, and transactivates an ARE battery of genes (Fig. 1A). The carboxy-terminal of Neh3 acts as a transactivation domain by interacting with the transcription co-activator known as CHD6 (chromo-ATPase/helicase DNA binding protein) [20]. Neh4 and Neh5 also act as transactivation domains, but bind to another transcriptional co-activator known as CBP (cAMP-response-element-binding protein-binding protein) [21]. Moreover, Neh4 and Neh5 interact with the nuclear cofactor RAC3/AIB1/SRC-3, leading to enhanced Nrf2-targeted ARE gene expression [22]. Neh5 has a redox-sensitive nuclear-export signal which is crucial for the regulation and cellular localization of Nrf2 [23].
Figure 1 Keap1-dependent and -independent regulation of Nrf2. (A) Under basal conditions, Nrf2 is sequestered with Keap1 by its two motifs (ETGE and DLG) that leads to CUL3-mediated ubiquitination followed by proteasome degradation. Under oxidative stress, Nrf2 dissociates from Keap1, translocates to the nucleus and activates the ARE-gene battery. (B) GSK3 phosphorylates Nrf2 and this facilitates the recognition of Nrf2 by ?-TrCP for CUL1-mediated ubiquitination and subsequent proteasome degradation. (C) p62 is sequestered with Keap1, leading to its autophagic degradation, the liberation of Nrf2, and increased Nrf2 signaling.
Keap1-Independent Nrf2 Regulation
Emerging evidence has revealed a novel mechanism of Nrf2 regulation that is independent of Keap1. The serine-rich Neh6 domain of Nrf2 plays a crucial role in this regulation by binding with its two motifs (DSGIS and DSAPGS) to ?-transducin repeat-containing protein (?-TrCP) [24]. ?-TrCP is a substrate receptor for the Skp1�Cul1�Rbx1/Roc1 ubiquitin ligase complex that targets Nrf2 for ubiquitination and proteasomal degradation. Glycogen synthase kinase-3 is a crucial protein involved in Keap1-independent Nrf2 stabilization and regulation; it phosphorylates Nrf2 in the Neh6 domain to facilitate the recognition of Nrf2 by ?-TrCP and subsequent protein degradation [25] (Fig. 1B).
Other Nrf2 Regulators
Another line of evidence has revealed a non-canonical pathway of p62-dependent Nrf2 activation in which p62 sequesters Keap1 to autophagic degradation that ultimately leads to the stabilization of Nrf2 and the transactivation of Nrf2-dependent genes [26], [27], [28], [29] (Fig. 1C).
Accumulating evidence suggests that several miRNAs play an important role in the regulation the Nrf2 activity [30]. Sangokoya et al. [31] demonstrated that miR-144 directly downregulates Nrf2 activity in the lymphoblast K562 cell line, primary human erythroid progenitor cells, and sickle-cell disease reticulocytes. Another interesting study in human breast epithelial cells demonstrated that miR-28 inhibits Nrf2 through a Keap1-independent mechanism [32]. Similarly, miRNAs such as miR-153, miR-27a, miR-142-5p, and miR144 downregulate Nrf2 expression in the neuronal SH-SY5Y cell line [33]. Singh et al. [34] demonstrated that the ectopic expression of miR-93 decreases the expression of Nrf2-regulated genes in a 17?-estradiol (E2)-induced rat model of mammary carcinogenesis.
A recent discovery from our lab identified an endogenous inhibitor of Nrf2 known as retinoic X receptor alpha (RXR?). RXR? is a nuclear receptor, interacts with the Neh7 domain of Nrf2 (amino-acid residues 209�316) via its DNA-binding domain (DBD), and specifically inhibits Nrf2 activity in the nucleus. Moreover, other nuclear receptors such as peroxisome proliferator-activated receptor-?, ER?, estrogen-related receptor-?, and glucocorticoid receptors have also been reported to be endogenous inhibitors of Nrf2 activity [9], [10].
Anti-Inflammatory Role of Nrf2/HO-1 Axis
HO-1 is the inducible isoform and rate-limiting enzyme that catalyzes the degradation of heme into carbon monoxide (CO) and free iron, and biliverdin to bilirubin. Enzymatic degradation of pro-inflammatory free heme as well as the production of anti-inflammatory compounds such as CO and bilirubin play major roles in maintaining the protective effects of HO-1 (Fig. 2).
Figure 2 Overview of the Nrf2/HO-1 pathway. Under basal conditions, Nrf2 binds to its repressor Keap1 which leads to ubiquitination followed by proteasome degradation. During oxidative stress, free Nrf2 translocates to the nucleus, where it dimerizes with members of the small Maf family and binds to ARE genes such as HO-1. Upregulated HO-1 catalyzes the heme into CO, bilirubin, and free iron. CO acts as an inhibitor of the NF-?B pathway which leads to the decreased expression of pro-inflammatory cytokines, while bilirubin also acts as antioxidant. Furthermore, HO-1 directly inhibits the proinflammatory cytokines as well as activating the anti-inflammatory cytokines, thus leads to balancing of the inflammatory process.
Nrf2 induces the HO-1 gene by increasing mRNA and protein expression and it is one of the classic Nrf2 regulated gene which is widely used in numerous in vitro and in vivo studies. Several studies have demonstrated that HO-1 and its metabolites have significant anti-inflammatory effects mediated by Nrf2. Elevation of HO-1 expression which is mediated by activated Nrf2 leads to the inhibition of NF?B signaling results in the reduced intestinal mucosal injury and tight-junction dysfunction in male Sprague-Dawley rat liver transplantation model [35]. Upregulation of Nrf2-dependent HO-1 expression may protect mouse derived C2C12 myoblasts from H2O2 cytotoxicity [36]. Nrf2-dependent HO-1 has an impact on lipopolysaccharide (LPS)-mediated inflammatory responses in RAW264.7- or mouse peritoneal macrophage-derived foam cell macrophages. Nrf2 activity desensitized foam cell macrophages phenotype and prevent immoderate inflammation of macrophages, those play important role in progression of atherosclerosis [37]. The Nrf2/HO-1 axis affects LPS induced mouse BV2 microglial cells and mouse hippocampal HT22 cells, with impact on neuroinflammation. Upregulation of HO-1 expression via Nrf2 pathway in mouse BV2 microglial cells which defend cell death of mouse hippocampal HT22 cells [38]. Furthermore, cobalt-based hybrid molecules (HYCOs) that combine an Nrf2 inducer with a releaser of carbon monoxide (CO) increases Nrf2/HO-1 expression, liberate CO and exert anti-inflammatory activity in vitro. HYCOs also up-regulate tissue HO-1 and deliver CO in blood after administration in vivo, supporting their potential use against inflammatory conditions [39]. Nrf2/HO-1 upregulation reduces inflammation by increasing the efferocytic activity of murine macrophages treated with taurine chloramines [40]. Altogether, the above-explained experimental models revealed that Nrf2/HO-1 axis plays a major role in anti-inflammatory function, suggesting that Nrf2 is a therapeutic target in inflammation-associated diseases.
In addition, the byproducts of HO-1 such as CO, bilirubin, acts as a powerful antioxidant during oxidative stress and cell damage [41], [42]; it suppresses autoimmune encephalomyelitis and hepatitis [43], [44]; and it protects mice and rats against endotoxic shock by preventing the generation of iNOS and NO [45], [46], [47]. Moreover, Bilirubin reduces endothelial activation and dysfunction [48]. Interestingly, bilirubin reduces the transmigration of endothelial leukocytes via adhesion molecule-1 [49]. These specific references indicating not only HO-1 acts as a potent anti-inflammatory agent but also its metabolites.
Inflammatory Mediators and Enzymes Inhibited by Nrf2
Cytokines and Chemokines
Cytokines are low molecular-weight proteins and polypeptides secreted by a variety of cells; they regulate cell growth, differentiation, and immune function, and are involved in inflammation and wound-healing. Cytokines include interleukins (ILs), interferons, tumor necrosis factor (TNF), colony-stimulating factor, chemokines, and growth factors. Some cytokines are counted as pro-inflammatory mediators whereas others have anti-inflammatory functions. Exposure to oxidative stress results in the overproduction of cytokines which causes oxidative stress in target cells. Several pro-inflammatory cytokines are overproduced when NF-?B is activated by oxidative stress. Furthermore, pro-inflammatory oxidative stress causes further activation of NF-?B and the overproduction of cytokines. Activation of the Nrf2/ARE system plays an important role in disrupting this cycle. Chemokines are a family of small cytokines, the major role of which is to guide the migration of inflammatory cells. They function mainly as chemoattractants for leukocytes, monocytes, neutrophils, and others effector cells.
It has been reported that activation of Nrf2 prevents LPS-induced transcriptional upregulation of pro-inflammatory cytokines, including IL-6 and IL-1? [50]. IL-1? and IL-6 production is also increased in Nrf2?/? mice with dextran sulfate-induced colitis [51], [52]. Nrf2 inhibits the production of downstream IL-17 and other inflammatory factors Th1 and Th17, and suppresses the disease process in an experimental model of multiple sclerosis, autoimmune encephalitis [53]. The Nrf2-dependent anti-oxidant genes HO-1, NQO-1, Gclc, and Gclm block TNF-?, IL-6, monocyte chemo attractant protein-1 (MCP1), macrophage inflammatory protein-2 (MIP2), and inflammatory mediators. But in the case of Nrf2-knockout mice, the anti-inflammatory effect does not occur [54]. Peritoneal neutrophils from Nrf2-knockout mice treated with LPS have significantly higher levels of cytokines (TNF-? and IL-6) and chemokines (MCP1 and MIP2) than wild-type (WT) cells [54]. In vitro, transferring the Nrf2 gene to human and rabbit aortic smooth muscle cells suppresses the secretion of MCP1 [8], [55], and Nrf2-dependent HO-1 expression suppresses TNF-?-stimulated NF-?B and MCP-1 secretion in human umbilical vein endothelial cells [56]. These findings hint that, in response to inflammatory stimuli, upregulation of Nrf2 signaling inhibits the overproduction of pro-inflammatory cytokines and chemokines as well as limiting the activation of NF-?B.
Cell Adhesion Molecules
Cell adhesion molecules (CAMs) are proteins that bind with cells or with the extracellular matrix. Located on the cell surface, they are involved in cell recognition, cell activation, signal transduction, proliferation, and differentiation. Among the CAMs, ICAM-1 and VCAM-1 are important members of the immunoglobulin superfamily. ICAM-1 is present in low concentrations in leukocyte and endothelial cell membranes. Upon cytokine stimulation, the concentration significantly increases. ICAM-1 can be induced by IL-1 and TNF and is expressed by the vascular endothelium, macrophages, and lymphocytes. It is a ligand for integrin, a receptor found on leukocytes. When the ICAM-1-integrin bridge is activated, leukocytes bind to endothelial cells and then migrate into subendothelial tissues [57]. VCAM-1 mediates the adhesion of lymphocytes, monocytes, eosinophils, and basophils to vascular endothelium and contributes to leukocyte recruitment, which ultimately leads to tissue damage due to oxidative stress. Nrf2 inhibits the promotor activity of VCAM-1 [58]. The Nrf2-regulated downstream gene HO-1 can affect the expression of E-selectin and VCAM-1, adhesion molecules associated with endothelial cells [59]. The pulmonary expression of several CAMs such as CD-14, TREM1, SELE, SELP, and VCAM-1 are significantly higher in Nrf2?/? mice than in Nrf2+/+ mice [60]. Nrf2 in human aortic endothelial cells suppress TNF-?-induced VCAM-1 expression and interfere with TNF-?-induced monocytic U937 cell adhesion [8]. Overexpression of Nrf2 also inhibits TNF-?-induced VCAM-1 gene expression in human microvascular endothelial cells [61]. The naturally occurring antioxidant 3-hydroxyanthranilic acid (HA), one of l-tryptophan metabolites formed in vivo along the metabolic route known as the kynurenine pathway during inflammation or infection, is found to induce HO-1 expression and to stimulate Nrf2 in human umbilical vein endothelial cells (HUVECs). Nrf2-dependent HO-1 expression induced by HA inhibits MCP-1 secretion, VCAM-1 expression and NF-kB activation associated with vascular injury and inflammation in atherosclerosis [56]. The anti-proliferative and anti-inflammatory synthetic chalcone derivative 2?,4?,6?-tris (methoxymethoxy) chalcone inhibits ICAM-1, the pro-inflammatory cytokine IL-1?, and TNF-? expression in colonic tissue from mice treated with trinitrobenzene sulfonic acid [62]. Upregulation of Nrf2 inhibits the TNF-?-induced ICAM-1 expression in human retinal pigment epithelial cells treated with lycopene [63]. All these studies suggest that Nrf2 plays a key role in the inflammatory process by regulating the migration and infiltration of inflammatory cells to inflamed tissue.
Matrix Metalloproteinases (MMPs)
MMPs are widely present in the extracellular matrix and are involved in physiological and pathological processes such as cell proliferation, migration, differentiation, wound-healing, angiogenesis, apoptosis, and tumor metastasis. It has been reported that the Nrf2/HO-1 axis inhibits MMP-9 in macrophages and MMP-7 in human intestinal epithelial cells, and this is beneficial in the treatment of inflammatory bowel disease [62], [64]. UV irradiation-induced skin damage is more severe in Nrf2-knockout than in WT mice and the MMP-9 level is significantly higher, indicating that Nrf2 reduces MMP-9 expression. Therefore, Nrf2 is considered to be protective against UV irradiation [65]. Another study also reported that the downregulated transcriptional activation of MMP-9 in tumor cell invasion and inflammation is regulated through inhibition of the NF-kB signaling pathway [66]. In traumatic spinal cord injury, the NF-kB signaling pathway also takes part in regulating the mRNA levels of MMP-9 [67]. Therefore, in inflammation the regulation of MMPs is affected directly by the Nrf2 pathway or indirectly through the Nrf2-influenced NF-?B pathway.
Cyclooxygenase-2 (COX2) and Inducible Nitric Oxide Synthase (INOS)
A series of experiments on Nrf2-knockout mice have demonstrated its crucial role in inflammation and the regulation of pro-inflammatory genes such as COX-2 and iNOS. For the first time, Khor et al. reported increased expression of pro-inflammatory cytokines such as COX-2 and iNOS in the colonic tissues of Nrf2?/? mice compared with WT Nrf2+/+ mice, indicating that Nrf2 suppresses their activity [51]. Another report on pretreatment with sulforaphane, one of the well-known Nrf2 activators present in cruciferous vegetables, demonstrated its anti-inflammatory effect of inhibiting the expression of TNF-?, IL-1?, COX-2, and iNOS at both the mRNA and protein levels in primary peritoneal macrophages from Nrf2+/+ mice compared with those from Nrf2?/? mice [68]. Similarly, the hippocampus of Nrf2-knockout mice with LPS-induced inflammation also shows higher expression of inflammation markers such as iNOS, IL-6, and TNF-? than WT mice [69]. Likewise, Nrf2-knockout mice are hypersensitive to the oxidative stress induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine as well as showing increased mRNA and protein levels of inflammation markers such as COX-2, iNOS, IL-6, and TNF-? [70]. Moreover, livers from Nrf2?/? mice challenged with a methionine- and choline-deficient diet have ~ 5-fold higher mRNA expression of Cox2, and iNOS than those from WT mice on the same diet, suggesting an anti-inflammatory role of Nrf2 [71]. Recently, Kim et al. demonstrated that the phytochemical ethyl pyruvate exerts its anti-inflammatory and anti-oxidative effects by decreasing the expression of iNOS through Nrf2 signaling in BV2 cells. They showed that ethyl pyruvate induces the nuclear translocation of Nrf2, which ultimately inhibits the interaction between p65 and p300, leading to decreased expression of iNOS [72]. Furthermore, the carbazole analogue LCY-2-CHO activates Nrf2 and causes its nuclear translocation, leading to the suppression of COX2 and iNOS expression [73] in rat aortic vascular smooth muscle cells.
Paradoxical Role of Nrf2 in the Regulation of NLRP3 iIflammasome�Activity
The NLR family, pyrin domain containing 3 (NLRP3) inflammasome is a multiprotein complex that functions as a pathogen recognition receptor (PRR) and recognizes the wide range of microbial, oxidative stress signals such as pathogen-associated molecular patterns (PAMPs), Damage-associated molecular pattern molecules (DAMPs) and ROS [74]. The activated NLRP3 inflammasome mediates the cleavage of caspase-1 and secretion of pro-inflammatory cytokine interleukin-1? (IL-1?) that ultimately induces the process of cell death known as pyroptosis that protects hosts against a wide range of pathogens [75]. However, aberrant activation of the inflammasome is associated with protein misfolding diseases such as transmissible spongiform encephalopathies, Alzheimer’s disease, Parkinson’s disease and also type 2 diabetes [76], cancer [77], gout, and atherosclerosis [78].
A recent observation from Rong Hu group on association of Nrf2 with negative regulation of inflammasome revealed that, Nrf2 induces the NQO1 expression that leads to the inhibition of NLRP3 inflammasome activation, caspase-1 cleavage and IL-1? generation in macrophages. Furthermore, a well known Nrf2 activator, tert-butylhydroquinone (tBHQ) negatively regulated NLRP3 transcription by activating the ARE by Nrf2-dependent manner [79]. In addition to the above observation, the same group has also been revealed that, dimethyl fumarate (DMF) prevents DSS-induced colitis via activating Nrf2 signaling pathway which is involved in Nrf2 nuclear translocation and inhibition of NLRP3 inflammasome assembly [80].
A series of experiments using natural and synthetic compounds have also revealed the inhibitory effect of Nrf2 on NLRP3 inflammasome activation. For instance, treatment of epigallocatechin-3-gallate (EGCG) in lupus nephritis mice has shown to decreasing renal NLRP3 inflammasome activation which is mediated by Nrf2 signaling pathway [81]. Likewise, citral (3,7-dimethyl-2,6-octadienal), a major active compound in a Chinese herbal medicine Litsea cubeba, inhibits the NLRP3 inflammasome activation via Nrf2 antioxidant signaling pathway in Accelerated and Severe Lupus Nephritis (ASLN) mouse model [82]. Similarly, biochanin protected against LPS/GalN-induced liver injury by activating the Nrf2 pathway and inhibiting NLRP3 inflammasome activation in male BALB/c mice [83]. Furthermore, mangiferin was also shown to up-regulate the expression of Nrf2 and HO-1 in a dose-dependent manner and inhibited LPS/D-GalN-induced hepatic NLRP3, ASC, caspase-1, IL-1? and TNF-? expression [84].
Despite the negative regulation of NLRP3 by Nrf2, it also activates the NLRP3 and AIM2 inflammasome function. Haitao Wen and colleagues discovered that, Nrf2 ?/? mouse macrophages have shown the defective activation of the NLRP3 and AIM2 Inflammasome but not the NLRC4 inflammasome [85]. Interestingly, this observation is depicting the unknown functions of Nrf2 in the context of inflammation associated diseases; hence it is very important to study further to reveal the mechanism in which Nrf2 activates the inflammasome function before considering it as a therapeutic target.
Suppression of Pro-Inflammatory Cytokine Transcription by Nrf2
A very recent investigation based on chromatin immunoprecipitation (ChIP)-seq and ChIP-qPCR results in mouse macrophages revealed that Nrf2 binds to the promoter regions of pro-inflammatory cytokines such as IL-6 and IL-1? and inhibits RNA Pol II recruitment. As a result, RNA Pol II is unable to process the transcriptional activation of IL-6 and IL-1? that ultimately leads to the inhibition of gene expression. For the first time, Masayuki Yamamoto’s group revealed the novel mechanism by which Nrf2 not only transactivates its downstream genes through AREs but also suppresses the transcriptional activation of specific genes with or without an ARE through inhibiting the recruitment of RNA Pol II [50].
Crosstalk Between Nrf2 and NF-?B Pathways
NF-?B is a protein complex responsible for DNA transcription found in almost all types of animal cells and involved in various processes such as inflammation, apoptosis, the immune response, cell growth, and development. p65, a Rel protein of the NF-?B family, has a transactivation domain whereas p50 does not and requires heterodimerization with Rel protein to activate transcription. During oxidative stress, I?B kinase (IKK) is activated and causes the phosphorylation of I?B, resulting in the release and nuclear translocation of NF-?B. NF-?B causes the transcription of pro-inflammatory mediators such as IL-6, TNF-?, iNOS, IL-1, and intracellular adhesion COX-2.
Abnormal regulation of NF-?B has been connected to rheumatoid arthritis, asthma, inflammatory bowel disease, and Helicobacter pylori infection-induced gastritis [86]. It is currently considered that NF-kB activity influences the Keapl/Nrf2/ARE signaling pathway mainly in three aspects: first, Keap1 degrades IKK? through ubiquitination, thus inhibiting the activity of NF-?B [87]. Second, the inflammatory process induces inflammatory mediators like COX2 derived from the cyclopentenone prostaglandin 15d-PGJ2, a strong electrophile that reacts with Keap1 and activates Nrf2, thus initiating gene transcription with simultaneous inhibition of NF-kB activity [58], [88] (Fig. 3 A, B). Third, NF-?B can combine with the competitive Nrf2 transcriptional co-activator CBP [89], [90] (Fig. 3 C, D).
Figure 3 Crosstalk between the Nrf2 and NF-?B pathways. (A) Keap1 directs the IKK to CUL3-mediated ubiquitination and proteasome degradation which ultimately leads to the inhibition of NF-?B phosphorylation and this mechanism also works as competitive binding of Nrf2 and IKK with Keap1. (B) Oxidative stress activates IKK which phosphorylates NF-?B, leading to its translocation into the nucleus and activation of proinflammatory cytokines such as COX-2. The terminal product of COX-2 known as 15d-PGJ2 acts as an inducer of Nrf2 that ultimately leads to the suppression of oxidative stress. (C) Nrf2 binds with its transcriptional cofactor CBP along with small Maf and other transcriptional machinery to initiate ARE-driven gene expression. (D) When NF-?B binds with CBP in a competitive manner, it inhibits the binding of CBP with Nrf2, which leads to the inhibition of Nrf2 transactivation.
It is assumed that the Nrf2 and NF-?B signaling pathways interact to control the transcription or function of downstream target proteins. In justification of this assumption many examples show that direct or indirect activation and inhibition occur between members of the Nrf2 and NF-?B pathways (Fig. 4). In response to LPS, Nrf2 knockdown significantly increases the NF-?B transcriptional activity and NF-?B-dependent gene transcription, showing that Nrf2 impedes NF-?B activity [60], [91]. In addition, increased expression of Nrf2-dependent downstream HO-1 inhibits NF-?B activity. When prostate cancer cells are briefly exposed to ?-tochopheryl succinate, a derivative of vitamin E, HO-1 expression is upregulated. The end-products of HO-1 inhibit the nuclear translocation of NF-?B [92]. These in vivo studies suggest that Nrf2 negatively regulates the NF-kB signaling pathway. LPS stimulates NF-?B DNA binding activity and the level of the p65 subunit of NF-?B is significantly higher in nuclear extracts from the lungs of Nrf2?/? than from WT mice, suggesting a negative role of Nrf2 in NF-?B activation. Moreover, Nrf2?/? mouse embryo fibroblasts treated with LPS and TNF-? show more prominent NF-?B activation caused by IKK activation and I?B-? degradation [60]. And respiratory syncytial virus clearance is significantly decreased while NF-?B DNA-binding activity is increased in Nrf2?/? mice compared with WT mice [93]. Pristane-induced lupus nephritis in Nrf2?/? mice co-treated with sulforaphane have severe renal damage and pathological alterations as well as elevated iNOS expression and NF-?B activation compared to the WT, suggesting that Nrf2 improves lupus nephritis by inhibiting the NF-?B signaling pathway and clearing ROS [94]. NF-?B activity also occurs when cells are treated with an Nrf2 inducer together with LPS and TNF-?. For example, a synthetic chalcone derivative inhibits TNF-?-induced NF-?B activation both directly and indirectly and partly through the induction of HO-1 expression in human intestinal epithelial HT-29 cells [62]. Suppression of NF-?B translocation and DNA-binding activity as well as the suppression of iNOS expression in hepatocytes are found when F344 rats are treated with 3H-1,2-dithiole-3-thione (D3T) [95]. After co-treatment with sulforaphane and LPS, the LPS-induced expression of iNOS, COX-2, and TNF-? in Raw 264.7 macrophages is downregulated, suggested that sulforaphane has anti-inflammatory activity via inhibition of NF-?B DNA binding [96]. Though several experimental studies have been done to explain the link between the Nrf2 and NF-?B pathways, conflicting results remain. Both positive and negative regulations have been reported between Nrf2 and NF-kB [97]. Usually, chemopreventive electrophiles 3H-1,2-dithiole-3-thione, sulforaphane and Triterpenoid CDDO-Me activate Nrf2 by inhibiting NF-kB and its downregulated genes [98], [99], [100]. In contrast, several agents or conditions such as ROS, LPS, flow shear stress, oxidized LDL, and cigarette smoke have been shown to increase both Nrf2 and NF-kB activity [97]. In addition, in vivo studies have revealed that NF-kB activity is decreased in livers isolated from Nrf2?/? mice and NF-?B binding activity is lower in Nrf2?/? than in Nrf2+/+ mice [101]. However, human aortic endothelial cells treated with adenoviral vector Nrf2 inhibit NF-?B downstream genes without affecting the activity of NF-?B [8]. Therefore, crosstalk between the Nrf2 and NF-?B pathways needs further investigation.
Figure 4 Regulatory loop of Nrf2 and NF-?B. The Nrf2 pathway inhibits NF-?B activation by preventing the degradation of I?B-? and increasing HO-1 expression and antioxidant defenses which neutralize ROS and detoxifying chemicals. As a result, ROS-associated NF-?B activation is suppressed. Likewise, NF-?B-mediated transcription reduces Nrf2 activation by reducing�ARE�gene transcription and free CREB binding protein by competing with Nrf2 for CBP. Moreover, NF-?B increases the recruitment of histone deacetylase (HDAC3) to the ARE region and hence Nrf2 transcriptional activation is prevented.
The activation of the Nrf2 signaling pathway plays a major role in the expression of enzymes and genes involved in the detoxification of reactive oxidants by enhancing the antioxidant capacity of the cells in the human body. While many research studies are available today, the regulatory mechanisms in Nrf2 activation are not fully understood. A possible role of the Nrf2 signaling pathway in the treatment of inflammation has also been found. Dr. Alex Jimenez D.C., C.C.S.T. Insight
Role of Nrf2 in Inflammatory Diseases
In vivo studies have shown that Nrf2 plays an important role in inflammatory diseases affecting different systems; these include gastritis, colitis, arthritis, pneumonia, liver damage, cardiovascular disease, neurodegenerative disease, and brain damage. In these studies, Nrf2?/? animals showed more severe symptoms of inflammation and tissue damage than WT animals. Therefore, it is believed that the Nrf2 signaling pathway has a protective effect in inflammatory diseases. Intra-tracheal installation of porcine pancreatic elastase induces chronic obstructive pulmonary disease, particularly emphysema. Nrf2-deficient mice are highly susceptible to emphysema, and decreased expression of HO-1, PrxI, and the antiprotease gene SLPI occur in alveolar macrophages. Nrf2 is considered to be a key regulator in the macrophage mediated defense system against lung injury [102]. Nrf2-deficient mice with emphysema induced by tobacco smoke exposure for 6 months show increased bronchoalveolar inflammation, upregulated expression of oxidative stress markers in alveoli, and increased alveolar septal cell apoptosis, suggesting that Nrf2 acts against tobacco-induced emphysema through the increased expression of antioxidant genes [102], [103]. With Nrf2 disruption, allergen-mediated airway inflammation and asthma using ovalbumin complex show increased airway inflammation, airway hyper-reactivity, hyperplasia of goblet cells, and high levels of Th2 in bronchoalveolar lavage and splenocytes, whereas the Nrf2-mediated signaling pathway limits airway eosinophilia, mucus hypersecretion, and airway hyper-reactivity as well as inducing many antioxidant genes that prevent the development of asthma [104]. Carrageenan injection into the pleural cavity induces pleurisy, and 15d-PGJ2 accumulation in Nrf2 inflammatory cells is confined to mouse peritoneal macrophages. During the early phase of inflammation, 15d-PGJ2 activates Nrf2 and regulates the inflammatory process via the induction of HO-1 and PrxI. A study also suggested that COX-2 has an anti-inflammatory effect in the early phase by the production of 15d-PGJ2 [105]. Oral administration of 1% dextran sulfate sodium for 1 week induces colitis associated with histological alterations that include shortening of crypts and infiltration of inflammatory cells in colon tissue. To protect intestinal integrity in colitis, Nrf2 could play an important role by regulating pro-inflammatory cytokines and inducing phase II detoxifying enzymes [51]. In an Nrf2-knockout mouse model of LPS-induced pulmonary sepsis, NF-?B activity regulates the influence of inflammatory cytokines such as COX-2, IL-113, IL-6, and TNF? which are essential for initiating and promoting inflammation [60]. Nrf2 reduces inflammatory damage by regulating these inflammatory factors. In these models of acute inflammation, the increased regulation of antioxidant enzymes, pro-inflammatory cytokines, and mediators by the Nrf2 signaling pathway reduces the inflammatory injury in WT animals. Interestingly, this has also been reported in Nrf2-knockout mice in which the symptoms are markedly exacerbated compared with WT mice. Nrf2-related inflammatory diseases are summarized (Table 1).
Research on Nrf2-Dependent Anti-Inflammatory Drugs
In summary, we have discussed experiments showing that the Nrf2 signal pathway plays a regulatory role in many areas of inflammation, so Nrf2-dependent anti-inflammatory agents are important for the treatment of inflammatory diseases.
Plants have been extraordinarily rich sources of compounds that activate Nrf2 transcription factor, leading to the up-regulation of cytoprotective genes. Recently, several studies were conducted to investigate the effects of different anti-inflammatory agents, mostly of plant origin. For example, curcumin is the active ingredient of turmeric and is also found in small amounts in ginger; isothiocyanates, specifically phenylisothiocyanates are from broccoli, celery, and other vegetables; and anthocyanins are from berries and grapes [124]. Studies have shown that all these agents are not only good antioxidants but also have potent anti-inflammatory effects via Nrf2 induction [125], [126]. Therefore, the development of new anti-inflammatory Nrf2 activators from plant extract has attracted much interest in medical research.
In recent years, many animal experiments have been conducted to confirm the actions of these compounds. Artesunate is used mainly for severe malaria, cerebral malaria, and rheumatic autoimmune diseases; it is also effective in septic lung injury. Artesunate activates Nrf2 and HO-1 expression, and the latter reduces the inflow of pro-inflammatory cytokines and leukocytes into tissue to prevent inflammation [127]. Isovitexin, extracted from the hulls of Oryza sativa rice, is thought to have anti-inflammatory and antioxidant properties; it plays a protective role against LPS-induced acute lung injury by activating the Nrf2/HO-1 pathway and inhibiting MAPK and NF-?B [128]. Fimasartan, a newly popular angiotensin II receptor blocker acting on the renin-angiotensin system, reduces blood pressure; using fimasartan to treat mice with surgically-induced unilateral ureteral obstruction reduces oxidative stress, inflammation, and fibrosis via upregulating Nrf2 and the antioxidant pathway and inhibiting RAS and MAPKs [129]. Sappanone is widely distributed in Southeast Asia, where it is used as an anti-influenza, anti-allergic, and neuroprotective medication; it activates Nrf2 and inhibits NF-?B and so may be beneficial in the treatment of Nrf2- and/or NF-?B-related diseases [130]. Bixin extracted from the seeds of Bixin orellana is used for infectious and inflammatory diseases in Mexico and South America; it decreases inflammatory mediators, alveolar capillary leakage, and oxidative damage in an Nrf2-dependent manner to alleviate ventilation-induced lung injury and restore normal lung morphology [131]. Other plant compounds, such as epigallocatechin gallate, sulforaphane, resveratrol, lycopene, and green tea extract have therapeutic effects on inflammatory diseases through the Nrf2 signaling pathway [132], [133], [134]. Recently another phytochemical, eriodictyol, which is present in citrus fruit, has been reported to have anti-inflammatory and antioxidant effects on cisplatin-induced kidney injury and sepsis-induced acute lung injury by regulating Nrf2, inhibiting NF-?B, and inhibiting the expression of cytokines in macrophages [135], [136]. However, numerous phytochemicals show great promise for the prevention and treatment of various human diseases, and some have already entered the clinical trials stage (Table 2).
These plant compounds activate the Nrf2 signaling pathway mainly in the form of electrophilic materials that modify the cysteine residues of Keap1, leading to free nuclear Nrf2 binding with the ARE, resulting in activation of transcription of the corresponding gene.
Sulforaphane and Its Effects on Cancer, Mortality, Aging, Brain and Behavior, Heart Disease & More
Isothiocyanates are some of the most important plant compounds you can get in your diet. In this video I make the most comprehensive case for them that has ever been made. Short attention span? Skip to your favorite topic by clicking one of the time points below. Full timeline below.
Key sections:
00:01:14 – Cancer and mortality
00:19:04 – Aging
00:26:30 – Brain and behavior
00:38:06 – Final recap
00:40:27 – Dose
Full timeline:
00:00:34 – Introduction of sulforaphane, a major focus of the video.
00:01:14 – Cruciferous vegetable consumption and reductions in all-cause mortality.
00:02:12 – Prostate cancer risk.
00:02:23 – Bladder cancer risk.
00:02:34 – Lung cancer in smokers risk.
00:02:48 – Breast cancer risk.
00:03:13 – Hypothetical: what if you already have cancer? (interventional)
00:03:35 – Plausible mechanism driving the cancer and mortality associative data.
00:04:38 – Sulforaphane and cancer.
00:05:32 – Animal evidence showing strong effect of broccoli sprout extract on bladder tumor development in rats.
00:06:06 – Effect of direct supplementation of sulforaphane in prostate cancer patients.
00:07:09 – Bioaccumulation of isothiocyanate metabolites in actual breast tissue.
00:08:32 – Inhibition of breast cancer stem cells.
00:08:53 – History lesson: brassicas were established as having health properties even in ancient Rome.
00:09:16 – Sulforaphane’s ability to enhance carcinogen excretion (benzene, acrolein).
00:09:51 – NRF2 as a genetic switch via antioxidant response elements.
00:10:10 – How NRF2 activation enhances carcinogen excretion via glutathione-S-conjugates.
00:10:34 – Brussels sprouts increase glutathione-S-transferase and reduce DNA damage.
00:11:20 – Broccoli sprout drink increases benzene excretion by 61%.
00:13:31 – Broccoli sprout homogenate increases antioxidant enzymes in the upper airway.
00:15:45 – Cruciferous vegetable consumption and heart disease mortality.
00:16:55 – Broccoli sprout powder improves blood lipids and overall heart disease risk in type 2 diabetics.
00:19:04 – Beginning of aging section.
00:19:21 – Sulforaphane-enriched diet enhances lifespan of beetles from 15 to 30% (in certain conditions).
00:20:34 – Importance of low inflammation for longevity.
00:22:05 – Cruciferous vegetables and broccoli sprout powder seem to reduce a wide variety of inflammatory markers in humans.
00:36:32 – Sulforaphane improves learning in model of type II diabetes in mice.
00:37:19 – Sulforaphane and duchenne muscular dystrophy.
00:37:44 – Myostatin inhibition in muscle satellite cells (in vitro).
00:38:06 – Late-video recap: mortality and cancer, DNA damage, oxidative stress and inflammation, benzene excretion, cardiovascular disease, type II diabetes, effects on the brain (depression, autism, schizophrenia, neurodegeneration), NRF2 pathway.
00:40:27 – Thoughts on figuring out a dose of broccoli sprouts or sulforaphane.
00:41:01 – Anecdotes on sprouting at home.
00:43:14 – On cooking temperatures and sulforaphane activity.
00:43:45 – Gut bacteria conversion of sulforaphane from glucoraphanin.
00:44:24 – Supplements work better when combined with active myrosinase from vegetables.
00:44:56 – Cooking techniques and cruciferous vegetables.
00:46:06 – Isothiocyanates as goitrogens.
Conclusions
Currently, much research has focused on the role of the Nrf2/Keap1/ARE signaling pathway in inflammation. Among the enzymes upregulated by Nrf2, HO-1 is one of the representative stress response enzymes. HO-1 has prominent anti-inflammatory and antioxidant properties. In general, the Nrf2 signaling pathway also negatively regulates cytokines, chemokine releasing factors, MMPs, and other inflammatory mediators COX-2 and iNOS production, which directly or indirectly affect the relevant NF-kB and MAPK pathways and other networks that control inflammation. It is suggested that the Nrf2 and NF-?B signaling pathways interact to regulate the transcription or function of downstream target proteins. Suppression or inactivation of NF-?B-mediated transcriptional activity through Nrf2 most probably occurs in the early phase of inflammation, as NF-?B regulates the de novo synthesis of an array of pro-inflammatory mediators. However, there are still some limitations in the research such as whether there are connections between Nrf2 and other signaling pathways such as JAK/STAT, the significance of the current Nrf2 activators derived from natural plant sources in inflammation, and how to improve the biological activity and enhance the targeting of these compounds. These require further experimental validation.
In addition, the Nrf2 signaling pathway can regulate > 600 genes [163], of which > 200 encode cytoprotective proteins [164] that are also associated with inflammation, cancer, neurodegenerative diseases, and other major diseases [165]. Growing evidences suggesting that, Nrf2 signaling pathway is deregulated in many cancers, resulting in aberrant expression Nrf2 dependent gene battery. Moreover, inflammation plays a major role in oxidative stress related diseases especially in cancer. Application of several Nrf2 activators to counteract the inflammation may result in aberrant expression of Nrf2 downstream genes which induces oncogenesis and resistance to chemo and/or radio therapy. Therefore, highly specific activators of Nrf2 may be developed to minimize its pleiotropic effects. Several activators of Nrf2 have shown a significant improvement of the anti-inflammatory functions in oxidative stress related diseases. The best example of Nrf2 activator approved by FDA and widely used for the treatment of inflammatory disease such as Multiple sclerosis (MS) is dimethyl fumarate. Tecfidera� (registered name of dimethyl fumarate by Biogen) used effectively to treat relapsing forms of multiple sclerosis in large number of patients [152]. However, the efficacy of using Nrf2 activators to treat inflammatory diseases requires further validation to avoid the deleterious effects of Nrf2. Therefore, development of therapies for the anti-inflammation activity mediated by Nrf2 could have significant clinical impact. Ongoing studies of the Nrf2 signaling pathway around the world are devoted to developing highly-targeted therapeutic agents to control the symptoms of inflammation, and to prevent and treat cancer as well as neurodegenerative and other major diseases.
In conclusion, Nrf2 senses the levels of oxidative stress in the human body and ultimately helps promote the regulation of antioxidant and detoxifying enzymes and genes. Because chronic inflammation caused by increased levels of oxidative stress has been associated with neurodegenerative diseases, Nrf2 can play an essential role in the treatment of health issues like Alzheimer’s disease, among others. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Additional Topic Discussion: Relieving Knee Pain without Surgery
Knee pain is a well-known symptom which can occur due to a variety of knee injuries and/or conditions, including�sports injuries. The knee is one of the most complex joints in the human body as it is made-up of the intersection of four bones, four ligaments, various tendons, two menisci, and cartilage. According to the American Academy of Family Physicians, the most common causes of knee pain include patellar subluxation, patellar tendinitis or jumper’s knee, and Osgood-Schlatter disease. Although knee pain is most likely to occur in people over 60 years old, knee pain can also occur in children and adolescents. Knee pain can be treated at home following the RICE methods, however, severe knee injuries may require immediate medical attention, including chiropractic care. �
About 1.5 million people in the United States have rheumatoid arthritis. Rheumatoid arthritis, or RA, is a chronic, autoimmune disease characterized by pain and inflammation of the joints. With RA, the immune system, which protects our well-being by attacking foreign substances like bacteria and viruses, mistakenly attacks the joints. Rheumatoid arthritis most commonly affects the joints of the hands, feet, wrists, elbows, knees and ankles. Many healthcare professionals recommend early diagnosis and treatment of RA.
Abstract
Rheumatoid arthritis is the most commonly diagnosed systemic inflammatory arthritis. Women, smokers, and those with a family history of the disease are most often affected. Criteria for diagnosis include having at least one joint with definite swelling that is not explained by another disease. The likelihood of a rheumatoid arthritis diagnosis increases with the number of small joints involved. In a patient with inflammatory arthritis, the presence of a rheumatoid factor or anti-citrullinated protein antibody, or elevated C-reactive protein level or erythrocyte sedimentation rate suggests a diagnosis of rheumatoid arthritis. Initial laboratory evaluation should also include complete blood count with dif- ferential and assessment of renal and hepatic function. Patients taking biologic agents should be tested for hepatitis B, hepatitis C, and tuberculosis. Earlier diagnosis of rheumatoid arthritis allows for earlier treatment with disease-modifying antirheumatic agents. Combinations of medications are often used to control the disease. Methotrexate is typically the first-line drug for rheumatoid arthritis. Biologic agents, such as tumor necrosis factor inhibitors, are generally considered second-line agents or can be added for dual therapy. The goals of treatment include minimiza- tion of joint pain and swelling, prevention of radiographic damage and visible deformity, and continuation of work and personal activities. Joint replacement is indicated for patients with severe joint damage whose symptoms are poorly controlled by medical management. (Am Fam Physician. 2011;84(11):1245-1252. Copyright � 2011 American Academy of Family Physicians.)
Rheumatoid arthritis (RA) is the most common inflammatory arthritis, with a lifetime prevalence of up to 1 percent worldwide.1 Onset can occur at any age, but peaks between 30 and 50 years.2 Disability is common and significant. In a large U.S. cohort, 35 percent of patients with RA had work disability after 10 years.3
Etiology and Pathophysiology
Like many autoimmune diseases, the etiology of RA is multifactorial. Genetic susceptibility is evident in familial clustering and monozygotic twin studies, with 50 percent of RA risk attributable to genetic factors.4 Genetic associations for RA include human leukocyte antigen-DR45 and -DRB1, and a variety of alleles called the shared epitope.6,7 Genome-wide association studies have identified additional genetic signatures that increase the risk of RA and other autoimmune diseases, including STAT4 gene and CD40 locus.5 Smoking is the major environmental trigger for RA, especially in those with a genetic predisposition.8 Although infections may unmask an autoimmune response, no particular pathogen has been proven to cause RA.9
RA is characterized by inflammatory pathways that lead to proliferation of synovial cells in joints. Subsequent pannus formation may lead to underlying cartilage destruction and bony erosions. Overproduction of pro-inflammatory cytokines, including tumor necrosis factor (TNF) and interleukin-6, drives the destructive process.10
Risk Factors
Older age, a family history of the disease, and female sex are associated with increased risk of RA, although the sex differential is less prominent in older patients.1 Both current and prior cigarette smoking increases the risk of RA (relative risk [RR] = 1.4, up to 2.2 for more than 40-pack-year smokers).11
Pregnancy often causes RA remission, likely because of immunologic tolerance.12 Parity may have long-lasting impact; RA is less likely to be diagnosed in parous women than in nulliparous women (RR = 0.61).13,14 Breastfeeding decreases the risk of RA (RR = 0.5 in women who breastfeed for at least 24 months), whereas early menarche�(RR = 1.3 for those with menarche at 10 years of age or younger) and very irregular menstrual periods (RR = 1.5) increase risk.14 Use of oral contraceptive pills or vitamin E does not affect RA risk.15
Diagnosis
Typical Presentation
Patients with RA typically present with pain and stiffness in multiple joints. The wrists, proximal interphalangeal joints, and metacarpophalangeal joints are most commonly involved. Morning stiffness lasting more than one hour suggests an inflammatory etiology. Boggy swelling due to synovitis may be visible (Figure 1), or subtle synovial thickening may be palpable on joint examination. Patients may also present with more indolent arthralgias before the onset of clinically apparent joint swelling. Systemic symptoms of fatigue, weight loss, and low-grade fever may occur with active disease.
Diagnostic Criteria
In 2010, the American College of Rheumatology and European League Against Rheumatism collaborated to create new classification criteria for RA (Table 1).16 The new criteria are an effort to diagnose RA earlier in patients who may not meet the 1987 American College of Rheumatology classification criteria. The 2010 criteria do not include presence of rheumatoid nodules or radiographic erosive changes, both of which are less likely in early RA. Symmetric arthri- tis is also not required in the 2010 criteria, allowing for early asymmetric presentation.
In addition, Dutch researchers have developed and validated a clinical prediction rule for RA (Table 2).17,18 The purpose of this rule is to help identify patients with undifferentiated arthritis that is most likely to progress to RA, and to guide follow-up and referral.
Diagnostic Tests
Autoimmune diseases such as RA are often characterized by the presence of autoanti- bodies. Rheumatoid factor is not specific for RA and may be present in patients with other diseases, such as hepatitis C, and in healthy older persons. Anti-citrullinated protein antibody is more specific for RA and may play a role in disease pathogenesis.6 Approxi- mately 50 to 80 percent of persons with RA have rheumatoid factor, anti-citrullinated protein antibody, or both.10 Patients with RA may have a positive antinuclear antibody test result, and the test is of prognostic impor- tance in juvenile forms of this disease.19 C-reactive protein levels and erythrocyte sedimentation rate are often increased with active RA, and these acute phase reactants are part of the new RA classification criteria.16 C-reactive protein levels and erythrocyte sedimentation rate may also be used to follow disease activity and response to medication.
Baseline complete blood count with differential and assessment of renal and hepatic function are helpful because the results may influence treatment options (e.g., a patient with renal insufficiency or significant thrombocytopenia likely would not be prescribed a nonsteroidal anti-inflammatory drug [NSAID]). Mild anemia of chronic disease occurs in 33 to 60 percent of all patients with RA,20 although gastrointestinal blood loss should also be considered in patients taking corticosteroids or NSAIDs. Methotrexate is contraindicated in patients with hepatic disease, such as hepatitis C, and in patients with significant renal impairment.21 Biologic therapy, such as a TNF inhibitor, requires a negative tuberculin test or treatment for latent tuberculosis. Hepatitis B reactivation can also occur with TNF inhibitor use.22 Radiography of hands and feet should be performed to evaluate for characteristic periarticular erosive changes,�which may be indicative of a more aggressive RA subtype.10
Differential Diagnosis
Skin findings suggest systemic lupus erythematosus, systemic sclerosis, or psoriatic arthritis. Polymyalgia rheumatica should be considered in an older patient with symptoms primarily in the shoulder and hip, and the patient should be asked questions related to associated temporal arteritis.
Chest radiography is helpful to evaluate for sarcoidosis as an etiology of arthritis.�Patients with inflammatory back symptoms, a history of inflammatory bowel disease, or inflammatory eye disease may have spondyloarthropathy. Persons with less than six weeks of symptoms may have a viral process, such as parvovirus. Recurrent self-limited episodes of acute joint swelling suggest crystal arthropathy, and arthrocentesis should be performed to evaluate for monosodium urate monohydrate or calcium pyrophosphate dihydrate crystals. The presence of numerous myofascial trigger points and somatic symptoms may suggest fibromyalgia, which can coexist with RA. To help guide diagnosis and determine treatment strategy, patients with inflammatory arthritis should be promptly referred to a rheumatology subspecialist.16,17
Rheumatoid arthritis, or RA, is the most common type of arthritis. RA is an autoimmune disease, caused when the immune system, the human body’s defense system, attacks its own cells and tissues, particularly the joints. Rheumatoid arthritis is frequently identified by symptoms of pain and inflammation, often affecting the small joints of the hands, wrists and feet. According to many healthcare professionals, early diagnosis and treatment of RA is essential to prevent further joint damage and decrease painful symptoms. Dr. Alex Jimenez D.C., C.C.S.T. Insight
Treatment
After RA has been diagnosed and an initial evaluation performed, treatment should begin. Recent guidelines have addressed the management of RA,21,22 but patient preference also plays an important role. There are special considerations for women of childbearing age because many medications have deleterious effects on pregnancy. Goals of therapy include minimizing joint pain and swelling, preventing deformity (such as ulnar deviation) and radiographic damage (such as erosions), maintaining quality of life (personal and work), and controlling extra-articular manifestations. Disease-modifying antirheumatic drugs (DMARDs) are the mainstay of RA therapy.
DMARDs
DMARDs can be biologic or nonbiologic (Table 3).23 Biologic agents include monoclonal antibodies and recombinant receptors to block cytokines that promote the inflammatory cascade responsible for RA symptoms. Methotrexate is recommended as the first- line treatment in patients with active RA, unless contraindicated or not tolerated.21 Leflunomide (Arava) may be used as an alternative to methotrexate, although gastrointestinal adverse effects are more common. Sulfasalazine (Azulfidine) or hydroxychloroquine (Plaquenil) pro-inflammatory as monotherapy in patients with low disease�activity or without poor prognostic features (e.g., seronegative, non-erosive RA).21,22
Combination therapy with two or more DMARDs is more effective than monotherapy; however, adverse effects may also be greater.24 If RA is not well controlled with a nonbiologic DMARD, a biologic DMARD should be initiated.21,22 TNF inhibitors are the first-line biologic therapy and are the most studied of these agents. If TNF inhibitors are ineffective, additional biologic therapies can be considered. Simultaneous use of more than one biologic therapy (e.g., adalimumab [Humira] with abatacept [Orencia]) is not�recommended because of an unacceptable rate of adverse effects.21
NSAIDs and Corticosteroids
Drug therapy for RA may involve NSAIDs and oral, intramuscular, or intra-articular corticosteroids for controlling pain and inflammation. Ideally, NSAIDs and corticosteroids are used only for short-term management. DMARDs are the preferred therapy.21,22
Complementary Therapies
Dietary interventions, including vegetarian and Mediterranean diets, have been�studied in the treatment of RA without convincing evidence of benefit.25,26 Despite some favorable outcomes, there is a lack of evidence for the effectiveness of acupuncture in placebo-controlled trials of patients with RA.27,28 In addition, thermotherapy and therapeutic ultrasound for RA have not been studied adequately.29,30 A Cochrane review of herbal treatments for RA concluded that gamma-linolenic acid (from evening primrose or black currant seed oil) and Tripterygium wilfordii (thunder god vine) have potential benefits.31 It is important to inform patients that serious adverse effects have been reported with use of herbal therapy.31
Exercise and Physical Therapy
Results of randomized controlled trials sup- port physical exercise to improve quality of life and muscle strength in patients with RA.32,33 Exercise training programs have not been shown to have deleterious effects on RA disease activity, pain scores, or radiographic joint damage.34 Tai chi has been shown to improve ankle range of motion in persons with RA, although randomized trials are limited.35 Randomized controlled trials of Iyengar yoga in young adults with RA are underway.36
Duration of Treatment
Remission is obtainable in 10 to 50 percent of patients with RA, depending on how remission is defined and the intensity of therapy.10 Remission is more likely in males, nonsmokers, persons younger than 40 years, and in those with late-onset disease (patients older than 65 years), with shorter duration of disease, with milder disease activity, without elevated acute phase reactants, and without positive rheumatoid factor or anti-citrullinated protein antibody findings.37
After the disease is controlled, medication dosages may be cautiously decreased to the minimum amount necessary. Patients will require frequent monitoring to ensure stable symptoms, and prompt increase in medication is recommended with disease flare-ups.22
Joint Replacement
Joint replacement is indicated when there is severe joint damage and unsatisfactory control of symptoms with medical management. Long-term outcomes are support, with only 4 to 13 percent of large joint replacements requiring revision within 10 years.38 The hip and knee are the most commonly replaced joints.
Long-Term Monitoring
Although RA is considered a disease of the joints, it is also a systemic disease capable of involving multiple organ systems. Extra-articular manifestations of RA are included in Table 4.1,2,10
Patients with RA have a twofold increased risk of lymphoma, which is thought to be caused by the underlying inflammatory�process, and not a consequence of medical treatment.39 Patients with RA are also at an increased risk of coronary artery disease, and physicians should work with patients to modify risk factors, such as smoking, high blood pressure, and high cholesterol.40,41 Class III or IV congestive heart failure (CHF) is a contraindication for using TNF inhibitors, which can worsen CHF outcomes.21 In patients with RA and malignancy, caution is needed with continued use of DMARDs, especially TNF inhibitors. Biologic DMARDs, methotrexate, and leflunomide should not be initiated in patients with active herpes zoster, significant fungal infection, or bacterial infection requiring antibiotics.21 Complications of RA and its treatments are listed in Table 5.1,2,10
Prognosis
Patients with RA live three to 12 years less than the general population.40 Increased mortality in these patients is mainly due to accelerated cardiovascular disease, especially in those with high disease activity and chronic inflammation. The relatively new biologic therapies may reverse progression of atherosclerosis and extend life in those with RA.41
Data Sources: A PubMed search was completed in Clinical Queries using the key terms rheumatoid arthritis, extra-articular manifestations, and disease-modifying antirheumatic agents. The search included meta-analyses, randomized controlled trials, clinical trials, and reviews. Also searched were the Agency for Healthcare Research and Quality evidence reports, Clinical Evidence, the Cochrane database, Essential Evidence, and UpToDate. Search date: September 20, 2010.
Author disclosure: No relevant financial affiliations to disclose.
In conclusion, rheumatoid arthritis is a chronic, autoimmune disease which causes painful symptoms, such as pain and discomfort, inflammation and swelling of the joints, among others. The joint damage characterized as RA is symmetrical, meaning it generally affects both sides of the body. Early�diagnosis is essential for treatment of RA. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Curated by Dr. Alex Jimenez
Additional Topic Discussion: Relieving Knee Pain without Surgery
Knee pain is a well-known symptom which can occur due to a variety of knee injuries and/or conditions, including�sports injuries. The knee is one of the most complex joints in the human body as it is made-up of the intersection of four bones, four ligaments, various tendons, two menisci, and cartilage. According to the American Academy of Family Physicians, the most common causes of knee pain include patellar subluxation, patellar tendinitis or jumper’s knee, and Osgood-Schlatter disease. Although knee pain is most likely to occur in people over 60 years old, knee pain can also occur in children and adolescents. Knee pain can be treated at home following the RICE methods, however, severe knee injuries may require immediate medical attention, including chiropractic care.
1. Etiology and pathogenesis of rheumatoid arthritis. In: Firestein GS, Kelley WN, eds. Kelley�s Textbook of Rheu- matology. 8th ed. Philadelphia, Pa.: Saunders/Elsevier; 2009:1035-1086. 2. Bathon J, Tehlirian C. Rheumatoid arthritis clinical and laboratory manifestations. In: Klippel JH, Stone JH, Crofford LJ, et al., eds. Primer on the Rheumatic Dis- eases. 13th ed. New York, NY: Springer; 2008:114-121. 3. Allaire S, Wolfe F, Niu J, et al. Current risk factors for work disability associated with rheumatoid arthritis. Arthritis Rheum. 2009;61(3):321-328. 4. MacGregor AJ, Snieder H, Rigby AS, et al. Characteriz- ing the quantitative genetic contribution to rheumatoid arthritis using data from twins. Arthritis Rheum. 2000; 43(1):30-37. 5. Orozco G, Barton A. Update on the genetic risk fac- tors for rheumatoid arthritis. Expert Rev Clin Immunol. 2010;6(1):61-75. 6. Balsa A, Cabezo?n A, Orozco G, et al. Influence of HLA DRB1 alleles in the susceptibility of rheumatoid arthritis and the regulation of antibodies against citrullinated proteins and rheumatoid factor. Arthritis Res Ther. 2010;12(2):R62. 7. McClure A, Lunt M, Eyre S, et al. Investigating the via- bility of genetic screening/testing for RA susceptibility using combinations of five confirmed risk loci. Rheuma- tology (Oxford). 2009;48(11):1369-1374. 8. Bang SY, Lee KH, Cho SK, et al. Smoking increases rheu- matoid arthritis susceptibility in individuals carrying the HLA-DRB1 shared epitope, regardless of rheumatoid factor or anti-cyclic citrullinated peptide antibody sta- tus. Arthritis Rheum. 2010;62(2):369-377. 9. Wilder RL, Crofford LJ. Do infectious agents cause rheu- matoid arthritis? Clin Orthop Relat Res. 1991;(265): 36-41. 10. Scott DL, Wolfe F, Huizinga TW. Rheumatoid arthritis. Lancet. 2010;376(9746):1094-1108. 11. Costenbader KH, Feskanich D, Mandl LA, et al. Smoking intensity, duration, and cessation, and the risk of rheu- matoid arthritis in women. Am J Med. 2006;119(6): 503.e1-e9. 12. Kaaja RJ, Greer IA. Manifestations of chronic disease during pregnancy. JAMA. 2005;294(21):2751-2757. 13. Guthrie KA, Dugowson CE, Voigt LF, et al. Does preg- nancy provide vaccine-like protection against rheuma- toid arthritis? Arthritis Rheum. 2010;62(7):1842-1848. 14. Karlson EW, Mandl LA, Hankinson SE, et al. Do breast- feeding and other reproductive factors influence future risk of rheumatoid arthritis? Results from the Nurses� Health Study. Arthritis Rheum. 2004;50(11):3458-3467. 15. Karlson EW, Shadick NA, Cook NR, et al. Vitamin E in the primary prevention of rheumatoid arthritis: the Women�s Health Study. Arthritis Rheum. 2008;59(11): 1589-1595. 16. Aletaha D, Neogi T, Silman AJ, et al. 2010 rheumatoid arthritis classification criteria: an American College of Rheumatology/European League Against Rheumatism collaborative initiative [published correction appears in Ann Rheum Dis. 2010;69(10):1892]. Ann Rheum Dis. 2010;69(9):1580-1588. 17. van der Helm-van Mil AH, le Cessie S, van Dongen H, et al. A prediction rule for disease outcome in patients with recent-onset undifferentiated arthritis. Arthritis Rheum. 2007;56(2):433-440. 18. Mochan E, Ebell MH. Predicting rheumatoid arthritis risk in adults with undifferentiated arthritis. Am Fam Physi- cian. 2008;77(10):1451-1453. 19. Ravelli A, Felici E, Magni-Manzoni S, et al. Patients with antinuclear antibody-positive juvenile idiopathic arthri- tis constitute a homogeneous subgroup irrespective of the course of joint disease. Arthritis Rheum. 2005; 52(3):826-832. 20. Wilson A, Yu HT, Goodnough LT, et al. Prevalence and outcomes of anemia in rheumatoid arthritis. Am J Med. 2004;116(suppl 7A):50S-57S. 21. Saag KG, Teng GG, Patkar NM, et al. American College of Rheumatology 2008 recommendations for the use of nonbiologic and biologic disease-modifying antirheu- matic drugs in rheumatoid arthritis. Arthritis Rheum. 2008;59(6):762-784. 22. Deighton C, O�Mahony R, Tosh J, et al.; Guideline Devel- opment Group. Management of rheumatoid arthritis: summary of NICE guidance. BMJ. 2009;338:b702. 23. AHRQ. Choosing medications for rheumatoid arthritis. April 9, 2008. http://www.effectivehealthcare.ahrq.gov/ ehc/products/14/85/RheumArthritisClinicianGuide.pdf. Accessed June 23, 2011. 24. Choy EH, Smith C, Dore? CJ, et al. A meta-analysis of the efficacy and toxicity of combining disease-modify- ing anti-rheumatic drugs in rheumatoid arthritis based on patient withdrawal. Rheumatology (Oxford). 2005; 4 4 (11) :1414 -1421. 25. Smedslund G, Byfuglien MG, Olsen SU, et al. Effective- ness and safety of dietary interventions for rheumatoid arthritis. J Am Diet Assoc. 2010;110(5):727-735. 26. Hagen KB, Byfuglien MG, Falzon L, et al. Dietary inter- ventions for rheumatoid arthritis. Cochrane Database Syst Rev. 2009;21(1):CD006400. 27. Wang C, de Pablo P, Chen X, et al. Acupuncture for pain relief in patients with rheumatoid arthritis: a systematic review. Arthritis Rheum. 2008;59(9):1249-1256. 28. Kelly RB. Acupuncture for pain. Am Fam Physician. 2009;80(5):481-484. 29. Robinson V, Brosseau L, Casimiro L, et al. Thermother- apy for treating rheumatoid arthritis. Cochrane Data- base Syst Rev. 2002;2(2):CD002826. 30. Casimiro L, Brosseau L, Robinson V, et al. Therapeutic ultrasound for the treatment of rheumatoid arthritis. Cochrane Database Syst Rev. 2002;3(3):CD003787. 31. Cameron M, Gagnier JJ, Chrubasik S. Herbal therapy for treating rheumatoid arthritis. Cochrane Database Syst Rev. 2011;(2):CD002948. 32. Brodin N, Eurenius E, Jensen I, et al. Coaching patients with early rheumatoid arthritis to healthy physical activ- ity. Arthritis Rheum. 2008;59(3):325-331. 33. Baillet A, Payraud E, Niderprim VA, et al. A dynamic exercise programme to improve patients� disability in rheumatoid arthritis: a prospective randomized con- trolled trial. Rheumatology (Oxford). 2009;48(4): 410-415. 34. Hurkmans E, van der Giesen FJ, Vliet Vlieland TP, et al. Dynamic Exercise programs (aerobic capacity and/or mus- cle strength training) in patients with rheumatoid arthri- tis. Cochrane Database Syst Rev. 2009;(4):CD006853. 35. Han A, Robinson V, Judd M, et al. Tai chi for treat- ing rheumatoid arthritis. Cochrane Database Syst Rev. 2004;(3):CD004849. 36. Evans S, Cousins L, Tsao JC, et al. A randomized con- trolled trial examining Iyengar yoga for young adults with rheumatoid arthritis. Trials. 2011;12:19. 37. Katchamart W, Johnson S, Lin HJ, et al. Predictors for remis- sion in rheumatoid arthritis patients: a systematic review. Arthritis Care Res (Hoboken). 2010;62(8):1128-1143. 38. Wolfe F, Zwillich SH. The long-term outcomes of rheu- matoid arthritis: a 23-year prospective, longitudinal study of total joint replacement and its predictors in 1,600 patients with rheumatoid arthritis. Arthritis Rheum. 1998;41(6):1072-1082. 39. Baecklund E, Iliadou A, Askling J, et al. Association of chronic inflammation, not its treatment, with increased lymphoma risk in rheumatoid arthritis. Arthritis Rheum. 2006;54(3):692-701. 40. Friedewald VE, Ganz P, Kremer JM, et al. AJC editor�s consensus: rheumatoid arthritis and atherosclerotic cardiovascular disease. Am J Cardiol. 2010;106(3): 442-447. 41. Atzeni F, Turiel M, Caporali R, et al. The effect of phar- macological therapy on the cardiovascular system of patients with systemic rheumatic diseases. Autoimmun Rev. 2010;9(12):835-839.
Arthritis is characterized as the inflammation of one or multiple joints. The most common symptoms of arthritis include pain and discomfort, swelling, inflammation, and stiffness, among others. Arthritis may affect�any joint in the human body, however, it commonly develops in the knee. � Knee arthritis can make everyday�physical activities difficult. The most prevalent types of arthritis are osteoarthritis and rheumatoid arthritis, although there are well over 100 distinct forms of arthritis, affecting children and adults alike. While there is no cure for arthritis, many treatment approaches can help treat the symptoms of knee arthritis.
Anatomy of the Knee
� The knee is the largest and strongest joint in the human body. It is made up of the lower end of the thigh bone,�or femur, the top end of the shin bone, or tibia, and the kneecap, or patella. The ends of the three bones are covered with articular cartilage, a smooth, slippery structure which protects and cushions the bones when bending and straightening the knee.
� Two wedge-shaped parts of cartilage, known as the meniscus, function as shock absorbers between the bones of the knee to help cushion the joint and provide stability. The knee joint is also surrounded by a thin lining known as the synovial membrane. This membrane releases a fluid which lubricates the cartilage and also helps reduce friction in the knee. The significant kinds of arthritis that affect the knee�include osteoarthritis, rheumatoid arthritis, and post-traumatic arthritis.
Osteoarthritis
� Osteoarthritis is the most common type of arthritis which affects the knee joint. This form of arthritis is a degenerative, wear-and-tear health issue which occurs most commonly in people 50 years of age and older, however, it may also develop in younger people.
� In osteoarthritis, the cartilage in the knee joint gradually wears away. As the cartilage wears away, the distance between the bones decreases. This can result in bone rubbing and it can�create painful bone spurs. Osteoarthritis generally develops slowly but the pain may worsen over time.
Rheumatoid Arthritis
� Rheumatoid arthritis is a chronic health issue which affects multiple joints throughout the body, especially the knee joint. RA is also symmetrical, meaning it often affects the same joint on each side of the human body.
� In rheumatoid arthritis, the synovial membrane that covers the knee joint becomes inflamed and swollen, causing knee pain, discomfort, and stiffness. RA is an autoimmune disease, which means that the immune system attacks its own soft tissues. The immune system attacks healthy tissue,�including tendons, ligaments and cartilage, as well as softens the bone.
Post-traumatic Arthritis
� Posttraumatic arthritis is a form of arthritis that develops after damage or injury to the knee. By way of instance, the knee joint may be harmed by a broken bone, or fracture, and result in post-traumatic arthritis years after the initial injury. Meniscal tears and ligament injuries can cause additional wear-and-tear on the knee joint, which over time can lead to arthritis and other problems.
Symptoms of Knee Arthritis
� The most common symptoms of knee arthritis include pain and discomfort, inflammation, swelling, and stiffness. Although sudden onset is probable, the painful symptoms generally�develop gradually over time. Additional symptoms of knee arthritis can be recognized as follows:
The joint may become stiff and swollen, making it difficult to bend and straighten the knee.
Swelling and inflammation may be worse in the morning, or when sitting or resting.
Vigorous activity might cause the pain to flare up.
Loose fragments of cartilage and other soft tissue may interfere with the smooth motion of the joints, causing the knee to lock or stick through motion. It could also creak, click, snap or make a grinding sound, known as crepitus.
Pain can cause a sense of fatigue or buckling from the knee.
Many individuals with arthritis may also describe increased joint pain with rainy weather and climate changes.
Diagnosis for Knee Arthritis
� During the patient’s appointment for diagnosis of knee arthritis, the healthcare professional will talk about the symptoms and medical history, as well as conduct a physical examination. The doctor may also order imaging diagnostic tests, such as X-rays, MRI or blood tests for further diagnosis. During the physical examination, the doctor will search for:
Joint inflammation, swelling, warmth, or redness
Tenderness around the knee joint
Assortment of passive and active movement
Instability of the knee joint
Crepitus, the grating sensation inside the joint, with motion
Pain when weight is placed on the knee
Issues with gait, or manner of walking
Any signs of damage or injury to the muscles, tendons, and ligaments surrounding the knee joint
Involvement of additional joints (an indicator of rheumatoid arthritis)
Imaging Diagnostic Tests
X-rays. These imaging diagnostic tests produce images of compact structures, such as bones. They can help distinguish among various forms of arthritis. X-rays for knee arthritis may demonstrate a portion of the joint distance, changes in the bone as well as the formation of bone spurs, known as osteophytes.
Additional tests. Sometimes, magnetic resonance imaging, or MRI, scans, computed tomography, or CT,�scans, or bone scans are required to ascertain the condition of the bone and soft tissues of the knee.
Blood Tests
� Your doctor may also recommend blood tests to determine which type of arthritis you have. With some kinds of arthritis, such as rheumatoid arthritis, blood tests can help with the proper identification of the disease.
Although the knee joint is one of the strongest and largest joints in the human body, it is often prone to suffering damage or injury, resulting in a variety of conditions. In addition, however, other health issues, such as arthritis, can affect the knee joint. In network for most insurances of El Paso, TX, chiropractic care can help ease painful symptoms associated with knee arthritis, among other health issues. Dr. Alex Jimenez D.C., C.C.S.T. Insight
�
Treatment for Knee Arthritis
Non-surgical Treatment
� Non-surgical treatment approaches are often recommended before considering surgical treatment for knee arthritis. Healthcare professionals may recommend a variety of treatment options, including chiropractic care, physical therapy, and lifestyle modifications, among others.
� Lifestyle modifications. Some lifestyle modifications can help protect the knee joint and impede the progress of arthritis. Minimizing physical activities which aggravate the condition, will put less strain on the knee. Losing weight may also help lessen stress and pressure on the knee joint, resulting in less painful symptoms and increased function.
� Chiropractic care and physical therapy.�Chiropractic care utilizes full body chiropractic adjustments to carefully restore any spinal misalignments, or subluxations, which may�be causing symptoms, including arthritis. The doctor may also recommend physical therapy to create an individualized exercise and physical activity program for each patient’s needs.�Specific exercises will help increase range of motion and endurance, as well as help strengthen the muscles in the lower extremities.
� Assistive devices. Using assistive devices, such as a cane, shock-absorbing shoes or inserts, or a brace or knee sleeve, can decrease painful symptoms. A brace helps with function and stability, and may be particularly useful if the arthritis is based on one side of the knee. There are two types of braces that are often used for knee arthritis: A “unloader” brace shifts weight from the affected section of the knee, while a “support” brace helps support the entire knee load.
� Drugs and/or medications. Several types of medications are useful in treating arthritis of the knee. Since individuals respond differently to medications, your doctor will work closely with you to determine the medications and dosages which are safe and effective for you.
Surgical Treatment
� The healthcare professional may recommend surgical treatment if the patient’s knee arthritis causes severe disability and only if the problem isn’t relieved with non-surgical treatment. Like all surgeries, there are a few risks and complications with surgical treatment for knee arthritis. The�doctor will discuss the possible problems with the patient.
� Arthroscopy. During arthroscopy, physicians use instruments and small incisions to diagnose and treat knee joint problems. Arthroscopic surgery isn’t frequently used in the treatment of arthritis of the knee. In cases where osteoarthritis is accompanied with a degenerative meniscal tear, arthroscopic surgery may be wise to treat the torn meniscus.
� Cartilage grafting. Normal cartilage tissue may be taken from a tissue bank or through a different part of the knee to fill out a hole in the articular cartilage. This process is typically considered only for younger patients.
� Synovectomy. The lining damaged by rheumatoid arthritis is eliminated to reduce swelling and pain.
� Osteotomy. In a knee osteotomy, either the tibia (shinbone) or femur (thighbone) is cut then reshaped to relieve stress and pressure on the knee joint. Knee�osteotomy is utilized when early-stage osteoarthritis has damaged one facet of the knee joint. By changing the weight distribution, this can relieve and enhance the function of the knee.
� Total or partial knee replacement (arthroplasty).�The�doctor will remove the damaged bone and cartilage, then place new plastic or metal surfaces to restore the function of the knee�and its surrounding structures.
� Following any type of surgery for knee�arthritis will involve a period of recovery. Recovery time and rehabilitation will depend on the type of surgery performed. It’s essential to talk with your healthcare professional to determine the best treatment option for your�knee arthritis. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
� Curated by Dr. Alex Jimenez �
�
Additional Topic Discussion: Relieving Knee Pain without Surgery
� Knee pain is a well-known symptom which can occur due to a variety of knee injuries and/or conditions, including�sports injuries. The knee is one of the most complex joints in the human body as it is made-up of the intersection of four bones, four ligaments, various tendons, two menisci, and cartilage. According to the American Academy of Family Physicians, the most common causes of knee pain include patellar subluxation, patellar tendinitis or jumper’s knee, and Osgood-Schlatter disease. Although knee pain is most likely to occur in people over 60 years old, knee pain can also occur in children and adolescents. Knee pain can be treated at home following the RICE methods, however, severe knee injuries may require immediate medical attention, including chiropractic care.
The knee is one of the most complex joints in the human body, consisting of the thigh bone, or femur, the shin bone, or tibia, and the kneecap, or patella, among other soft tissues. Tendons connect the bones to the muscles while ligaments connect the bones of the knee joint. Two wedge-shaped pieces of cartilage, known as the meniscus, provide stability to the knee joint. The purpose of the article below is to demonstrate as well as discuss the anatomy of the knee joint and its surrounding soft tissues.
Abstract
Context: Information regarding the structure, composition, and function of the knee menisci has been scattered across multiple sources and fields. This review contains a concise, detailed description of the knee menisci�including anatomy, etymology, phylogeny, ultrastructure and biochemistry, vascular anatomy and neuroanatomy, biomechanical function, maturation and aging, and imaging modalities.
Evidence Acquisition: A literature search was performed by a review of PubMed and OVID articles published from 1858 to 2011.
Results: This study highlights the structural, compositional, and functional characteristics of the menisci, which may be relevant to clinical presentations, diagnosis, and surgical repairs.
Conclusions: An understanding of the normal anatomy and biomechanics of the menisci is a necessary prerequisite to understanding the pathogenesis of disorders involving the knee.
Keywords:knee, meniscus, anatomy, function
Introduction
Once described as a functionless embryonic remnant,162 the menisci are now known to be vital for the normal function and long-term health of the knee joint.� The menisci increase stability for femorotibial articulation, distribute axial load, absorb shock, and provide lubrication and nutrition to the knee joint.4,91,152,153
Injuries to the menisci are recognized as a cause of significant musculoskeletal morbidity. The unique and complex structure of menisci makes treatment and repair challenging for the patient, surgeon, and physical therapist. Furthermore, long-term damage may lead to degenerative joint changes such as osteophyte formation, articular cartilage degeneration, joint space narrowing, and symptomatic osteoarthritis.36,45,92 Preservation of the menisci depends on maintaining their distinctive composition and organization.
Anatomy of Menisci
Meniscal Etymology
The word meniscus comes from the Greek word m?niskos, meaning �crescent,� diminutive of m?n?, meaning �moon.�
Meniscal Phylogeny and Comparative Anatomy
Hominids exhibit similar anatomic and functional characteristics, including a bicondylar distal femur, intra-articular cruciate ligaments, menisci, and asymmetrical collateral.40,66 These similar morphologic characteristics reflect a shared genetic lineage that can be traced back more than 300 million years.40,66,119
In the primate lineage leading to humans, hominids evolved to bipedal stance approximately 3 to 4 million years ago, and by 1.3 million years ago, the modern patellofemoral joint was established (with a longer lateral patellar facet and matching lateral femoral trochlea).164 Tardieu investigated the transition from occasional bipedalism to permanent bipedalism and observed that primates contain a medial and lateral fibrocartilaginous meniscus, with the medial meniscus being morphologically similar in all primates (crescent shaped with 2 tibial insertions).163 By contrast, the lateral meniscus was observed to be more variable in shape. Unique in Homo sapiens is the presence of 2 tibial insertions�1 anterior and 1 posterior�indicating a habitual practice of full extension movements of the knee joint during the stance and swing phases of bipedal walking.20,134,142,163,168
Embryology and Development
The characteristic shape of the lateral and medial menisci is attained between the 8th and 10th week of gestation.53,60 They arise from a condensation of the intermediate layer of mesenchymal tissue to form attachments to the surrounding joint capsule.31,87,110 The developing menisci are highly cellular and vascular, with the blood supply entering from the periphery and extending through the entire width of the menisci.31 As the fetus continues to develop, there is a gradual decrease in the cellularity of the menisci with a concomitant increase in the collagen content in a circumferential arrangement.30,31 Joint motion and the postnatal stress of weightbearing are important factors in determining the orientation of collagen fibers. By adulthood, only the peripheral 10% to 30% have a blood supply.12,31
Despite these histologic changes, the proportion of tibial plateau covered by the corresponding meniscus is relatively constant throughout fetal development, with the medial and lateral menisci covering approximately 60% and 80% of the surface areas, respectively.31
Gross Anatomy
Gross examination of the knee menisci reveals a smooth, lubricated tissue (Figure 1). They are crescent-shaped wedges of fibrocartilage located on the medial and lateral aspects of the knee joint (Figure 2A). The peripheral, vascular border (also known as the red zone) of each meniscus is thick, convex, and attached to the joint capsule. The innermost border (also known as the white zone) tapers to a thin free edge. The superior surfaces of menisci are concave, enabling effective articulation with their respective convex femoral condyles. The inferior surfaces are flat to accommodate the tibial plateau (Figure 1).28,175
Medial meniscus. The semicircular medial meniscus measures approximately 35 mm in diameter (anterior to posterior) and is significantly broader posteriorly than it is anteriorly.175 The anterior horn is attached to the tibia plateau near the intercondylar fossa anterior to the anterior cruciate ligament (ACL). There is significant variability in the attachment location of the anterior horn of the medial meniscus. The posterior horn is attached to the posterior intercondylar fossa of the tibia between the lateral meniscus and the posterior cruciate ligament (PCL; Figures 1 and and2B).2B). Johnson et al reexamined the tibial insertion sites of the menisci and their topographic relationships to surrounding anatomic landmarks of the knee.82 They found that the anterior and posterior horn insertion sites of the medial meniscus were larger than those of the lateral meniscus. The area of the anterior horn insertion site of the medial meniscus was the largest overall, measuring 61.4 mm2, whereas the posterior horn of the lateral meniscus was the smallest, at 28.5 mm2.82
The tibial portion of the capsular attachment is the coronary ligament. At its midpoint, the medial meniscus is more firmly attached to the femur through a condensation in the joint capsule known as the deep medial collateral ligament.175 The transverse, or �intermeniscal,� ligament is a fibrous band of tissue that connects the anterior horn of the medial meniscus to the anterior horn of the lateral meniscus (Figures 1 and and2A2A).
Lateral meniscus. The lateral meniscus is almost circular, with an approximately uniform width from anterior to posterior (Figures 1 and and2A).2A). It occupies a larger portion (~80%) of the articular surface than the medial meniscus (~60%) and is more mobile.10,31,165 Both horns of the lateral meniscus are attached to the tibia. The insertion of the anterior horn of the lateral meniscus lies anterior to the intercondylar eminence and adjacent to the broad attachment site of the ACL (Figure 2B).9,83 The posterior horn of the lateral meniscus inserts posterior to the lateral tibial spine and just anterior to the insertion of the posterior horn of the medial meniscus (Figure 2B).83 The lateral meniscus is loosely attached to the capsular ligament; however, these fibers do not attach to the lateral collateral ligament. The posterior horn of the lateral meniscus attaches to the inner aspect of the medial femoral condyle via the anterior and posterior meniscofemoral ligaments of Humphrey and Wrisberg, respectively, which originate near the origin of the PCL (Figures 1 and and22).75
Meniscofemoral ligaments. The literature reports significant inconsistencies in the presence and size of meniscofemoral ligaments of the lateral meniscus. There may be none, 1, 2, or 4.? When present, these accessory ligaments transverse from the posterior horn of the lateral meniscus to the lateral aspect of the medial femoral condyle. They insert immediately adjacent to the femoral attachment of the PCL (Figures 1 and and22).
In a series of studies, Harner et al measured the cross-sectional area of the ligaments and found that the meniscofemoral ligament averaged 20% of the size of the PCL (range, 7%-35%).69,70 However, the size of the insertional area alone without knowledge of the insertional angle or collagen density does not indicate their relative strength.115 The function of these ligaments remains unknown; they may pull the posterior horn of the lateral meniscus in an anterior direction to increase the congruity of the meniscotibial fossa and the lateral femoral condyle.75
Ultrastructure and Biochemistry
Extracellular Matrix
The meniscus is a dense extracellular matrix (ECM) composed primarily of water (72%) and collagen (22%), interposed with cells.9,55,56,77 Proteoglycans, noncollagenous proteins, and glycoproteins account for the remaining dry weight.� Meniscal cells synthesize and maintain the ECM, which determines the material properties of the tissue.
The cells of the menisci are referred to as fibrochondrocytes because they appear to be a mixture of fibroblasts and chondrocytes.111,177 The cells in the more superficial layer of the menisci are fusiform or spindle shaped (more fibroblastic), whereas the cells located deeper in the meniscus are ovoid or polygonal (more chondrocytic).55,56,178 Cell morphology does not differ between the peripheral and central locations in the menisci.56
Both cell types contain abundant endoplasmic reticulum and Golgi complex. Mitochondria are only occasionally visualized, suggesting that the major pathway for energy production of fibrochondrocytes in their avascular milieu is probably anaerobic glycolysis.112
Water
In normal, healthy menisci, tissue fluid represents 65% to 70% of the total weight. Most of the water is retained within the tissue in the solvent domains of proteoglycans. The water content of meniscal tissue is higher in the posterior areas than in the central or anterior areas; tissue samples from surface and deeper layers had similar contents.135
Large hydraulic pressures are required to overcome the drag of frictional resistance of forcing fluid flow through meniscal tissue. Thus, interactions between water and the matrix macromolecular framework significantly influence the viscoelastic properties of the tissue.
Collagens
Collagens are primarily responsible for the tensile strength of menisci; they contribute up to 75% of the dry weight of the ECM.77 The ECM is composed primarily of type I collagen (90% dry weight) with variable amounts of types II, III, V, and VI.43,44,80,112,181 The predominance of type I collagen distinguishes the fibrocartilage of menisci from articular (hyaline) cartilage. The collagens are heavily cross-linked by hydroxylpyridinium aldehydes.44
The collagen fiber arrangement is ideal for transferring a vertical compressive load into circumferential �hoop� stresses (Figure 3).57 Type I collagen fibers are oriented circumferentially in the deeper layers of the meniscus, parallel to the peripheral border. These fibers blend the ligamentous connections of the meniscal horns to the tibial articular surface (Figure 3).10,27,49,156 In the most superficial region of the menisci, the type I fibers are oriented in a more radial direction. Radially oriented �tie� fibers are also present in the deep zone and are interspersed or woven between the circumferential fibers to provide structural integrity (Figure 3).# There is lipid debris and calcified bodies in the ECM of human menisci.54 The calcified bodies contain long, slender crystals of phosphorous, calcium, and magnesium on electron-probe roentgenographic analysis.54 The function of these crystals in not completely understood, but it is believed that they may play a role in acute joint inflammation and destructive arthropathies.
Noncollagenous matrix proteins, such as fibronectin, contribute 8% to 13% of the organic dry weight. Fibronectin is involved in many cellular processes, including tissue repair, embryogenesis, blood clotting, and cell migration/adhesion. Elastin forms less than 0.6% of the meniscus dry weight; its ultrastructural localization is not clear. It likely interacts directly with collagen to provide resiliency to the tissue.**
Proteoglycans
Located within a fine meshwork of collagen fibrils, proteoglycans are large, negatively charged hydrophilic molecules, contributing 1% to 2% of dry weight.58 They are formed by a core protein with 1 or more covalently attached glycosaminoglycan chains (Figure 4).122 The size of these molecules is further increased by specific interaction with hyaluronic acid.67,72 The amount of proteoglycans in the meniscus is one-eighth that of articular cartilage,2,3 and there may be considerable variation depending on the site of the sample and the age of the patient.49
By virtue of their specialized structure, high fixed-charge density, and charge-charge repulsion forces, proteoglycans in the ECM are responsible for hydration and provide the tissue with a high capacity to resist compressive loads.� The glycosaminoglycan profile of the normal adult human meniscus consists of chondroitin-6-sulfate (40%), chondroitin-4-sulfate (10% to 20%), dermatan sulfate (20% to 30%), and keratin sulfate (15%; Figure 4).65,77,99,159 The highest glycosaminoglycan concentrations are found in the meniscal horns and the inner half of the menisci in the primary weightbearing areas.58,77
Aggrecan is the major proteoglycan found in the human menisci and is largely responsible for their viscoelastic compressive properties (Figure 5). Smaller proteoglycans, such as decorin, biglycan, and fibromodulin, are found in smaller amounts.124,151 Hexosamine contributes 1% to the dry weight of ECM.57,74 The precise functions of each of these small proteoglycans on the meniscus have yet to be fully elucidated.
Matrix Glycoproteins
Meniscal cartilage contains a range of matrix glycoproteins, the identities and functions of which have yet to be determined. Electrophoresis and subsequent staining of the polyacrylamide gels reveals bands with molecular weights varying from a few kilodaltons to more than 200 kDa.112 These matrix molecules include the link proteins that stabilize proteoglycan�hyaluronic acid aggregates and a 116-kDa protein of unknown function.46 This protein resides in the matrix in the form of disulfide-bonded complex of high molecular weight.46 Immunolocalization studies suggest that it is predominantly located around the collagen bundles in the interterritorial matrix.47
The adhesive glycoproteins constitute a subgroup of the matrix glycoproteins. These macromolecules are partly responsible for binding with other matrix molecules and/or cells. Such intermolecular adhesion molecules are therefore important components in the supramolecular organization of the extracellular molecules of the meniscus.150 Three molecules have been identified within the meniscus: type VI collagen, fibronectin, and thrombospondin.112,118,181
Vascular Anatomy
The meniscus is a relatively avascular structure with a limited peripheral blood supply. The medial, lateral, and middle geniculate arteries (which branch off the popliteal artery) provide the major vascularization to the inferior and superior aspects of each meniscus (Figure 5).9,12,33-35,148 The middle geniculate artery is a small posterior branch that perforates the oblique popliteal ligament at the posteromedial corner of the tibiofemoral joint. A premeniscal capillary network arising from the branches of these arteries originates within the synovial and capsular tissues of the knee along the periphery of the menisci. The peripheral 10% to 30% of the medial meniscus border and 10% to 25% of the lateral meniscus are relatively well vascularized, which has important implications for meniscus healing (Figure 6).12,33,68 Endoligamentous vessels from the anterior and posterior horns travel a short distance into the substance of the menisci and form terminal loops, providing a direct route for nourishment.33 The remaining portion of each meniscus (65% to 75%) receives nourishment from synovial fluid via diffusion or mechanical pumping (ie, joint motion).116,120
Bird and Sweet examined the menisci of animals and humans using scanning electron and light microscopy.23,24 They observed canal-like structures opening deep into the surface of the menisci. These canals may play a role in the transport of fluid within the meniscus and may carry nutrients from the synovial fluid and blood vessels to the avascular sections of the meniscus.23,24 However, further study is needed to elucidate the exact mechanism by which mechanical motion supplies nutrition to the avascular portion of the menisci.
Neuroanatomy
The knee joint is innervated by the posterior articular branch of the posterior tibial nerve and the terminal branches of the obturator and femoral nerves. The lateral portion of the capsule is innervated by the recurrent peroneal branch of the common peroneal nerve. These nerve fibers penetrate the capsule and follow the vascular supply to the peripheral portion of the menisci and the anterior and posterior horns, where most of the nerve fibers are concentrated.52,90 The outer third of the body of the meniscus is more densely innervated than the middle third.183,184 During extremes of flexion and extension of the knee, the meniscal horns are stressed, and the afferent input is likely greatest at these extreme positions.183,184
The mechanoreceptors within the menisci function as transducers, converting the physical stimulus of tension and compression into a specific electrical nerve impulse. Studies of human menisci have identified 3 morphologically distinct mechanoreceptors: Ruffini endings, Pacinian corpuscles, and Golgi tendon organs.�� Type I (Ruffini) mechanoreceptors are low threshold and slowly adapting to the changes in joint deformation and pressure. Type II (Pacinian) mechanoreceptors are low threshold and fast adapting to tension changes.�� Type III (Golgi) are high-threshold mechanoreceptors, which signal when the knee joint approaches the terminal range of motion and are associated with neuromuscular inhibition. These neural elements were found in greater concentration in the meniscal horns, particularly the posterior horn.
The asymmetrical components of the knee act in concert as a type of biological transmission that accepts, transfers, and dissipates loads along the femur, tibia, patella, and femur.41 Ligaments act as an adaptive linkage, with the menisci representing mobile bearings. Several studies have reported that various intra-articular components of the knee are sensate, capable of generating neurosensory signals that reach spinal, cerebellar, and higher central nervous system levels.?? It is believed that these neurosensory signals result in conscious perception and are important for normal knee joint function and maintenance of tissue homeostasis.42
The meniscus is cartilage which provides structural and functional integrity to the knee. The menisci are two pads of fibrocartilaginous tissue which spread out friction in the knee joint when it undergoes tension and torsion between the shin bone, or tibia, and the thigh bone, or femur. The understanding of the anatomy and biomechanics of the knee joint is essential towards the understanding of knee injuries and/or conditions. Dr. Alex Jimenez D.C., C.C.S.T. Insight
�
Biomechanical Function
The biomechanical function of the meniscus is a reflection of the gross and ultrastructural anatomy and of its relationship to the surrounding intra-articular and extra-articular structures. The menisci serve many important biomechanical functions. They contribute to load transmission,�� shock absorption,10,49,94,96,170 stability,51,100,101,109,155 nutrition,23,24,84,141 joint lubrication,102-104,141 and proprioception.5,15,81,88,115,147 They also serve to decrease contact stresses and increase contact area and congruity of the knee.91,172
Meniscal Kinematics
In a study on ligamentous function, Brantigan and Voshell reported the medial meniscus to move an average 2 mm, while the lateral meniscus was markedly more mobile with approximately 10 mm of anterior-posterior displacement during flexion.25 Similarly, DePalma reported that the medial meniscus undergoes 3 mm of anterior-posterior displacement, while the lateral meniscus moves 9 mm during flexion.37 In a study using 5 cadaveric knees, Thompson et al reported the mean medial excursion to be 5.1 mm (average of anterior and posterior horns) and the mean lateral excursion, 11.2 mm, along the tibial articular surface (Figure 7).165 The findings from these studies confirm a significant difference in segmental motion between the medial and lateral menisci. The anterior and posterior horn lateral meniscus ratio is smaller and indicates that the meniscus moves more as a single unit.165 Alternatively, the medial meniscus (as a whole) moves less than the lateral meniscus, displaying a greater anterior to posterior horn differential excursion. Thompson et al found that the area of least meniscal motion is the posterior medial corner, where the meniscus is constrained by its attachment to the tibial plateau by the meniscotibial portion of the posterior oblique ligament, which has been reported to be more prone to injury.143,165 A reduction in the motion of the posterior horn of the medial meniscus is a potential mechanism for meniscal tears, with a resultant �trapping� of the fibrocartilage between the femoral condyle and the tibial plateau during full flexion. The greater differential between anterior and posterior horn excursion may place the medial meniscus at a greater risk of injury.165
The differential of anterior horn to posterior horn motion allows the menisci to assume a decreasing radius with flexion, which correlates to the decreased radius of curvature of the posterior femoral condyles.165 This change of radius allows the meniscus to maintain contact with the articulating surface of both the femur and the tibia throughout flexion.
Load Transmission
The function of the menisci has been clinically inferred by the degenerative changes that accompany its removal. Fairbank described the increased incidence and predictable degenerative changes of the articular surfaces in completely meniscectomized knees.45 Since this early work, numerous studies have confirmed these findings and have further established the important role of the meniscus as a protective, load-bearing structure.
Weightbearing produces axial forces across the knee, which compress the menisci, resulting in �hoop� (circumferential) stresses.170 Hoop stresses are generated as axial forces and converted to tensile stresses along the circumferential collagen fibers of the meniscus (Figure 8). Firm attachments by the anterior and posterior insertional ligaments prevent the meniscus from extruding peripherally during load bearing.94 Studies by Seedhom and Hargreaves reported that 70% of the load in the lateral compartment and 50% of the load in the medial compartment is transmitted through the menisci.153 The menisci transmit 50% of compressive load through the posterior horns in extension, with 85% transmission at 90� flexion.172 Radin et al demonstrated that these loads are well distributed when the menisci are intact.137 However, removal of the medial meniscus results in a 50% to 70% reduction in femoral condyle contact area and a 100% increase in contact stress.4,50,91 Total lateral meniscectomy results in a 40% to 50% decrease in contact area and increases contact stress in the lateral component to 200% to 300% of normal.18,50,76,91 This significantly increases the load per unit area and may contribute to accelerated articular cartilage damage and degeneration.45,85
Shock Absorption
The menisci play a vital role in attenuating the intermittent shock waves generated by impulse loading of the knee with normal gait.94,96,153 Voloshin and Wosk showed that the normal knee has a shock-absorbing capacity about 20% higher than knees that have undergone meniscectomy.170 As the inability of a joint system to absorb shock has been implicated in the development of osteoarthritis, the meniscus would appear to play an important role in maintaining the health of the knee joint.138
Joint Stability
The geometric structure of the menisci provides an important role in maintaining joint congruity and stability.## The superior surface of each meniscus is concave, enabling effective articulation between the convex femoral condyles and flat tibial plateau. When the meniscus is intact, axial loading of the knee has a multidirectional stabilizing function, limiting excess motion in all directions.9
Markolf and colleagues have addressed the effect of meniscectomy on anterior-posterior and rotational knee laxity. Medial meniscectomy in the ACL-intact knee has little effect on anterior-posterior motion, but in the ACL-deficient knee, it results in an increase in anterior-posterior tibial translation of up to 58% at 90o of flexion.109 Shoemaker and Markolf demonstrated that the posterior horn of the medial meniscus is the most important structure resisting an anterior tibial force in the ACL-deficient knee.155 Allen et al showed that the resultant force in the medial meniscus of the ACL-deficient knee increased by 52% in full extension and by 197% at 60� of flexion under a 134-N anterior tibial load.7 The large changes in kinematics due to medial meniscectomy in the ACL-deficient knee confirm the important role of the medial meniscus in knee stability. Recently, Musahl et al reported that the lateral meniscus plays a role in anterior tibial translation during the pivot-shift maneuver.123
Joint Nutrition and Lubrication
The menisci may also play a role in the nutrition and lubrication of the knee joint. The mechanics of this lubrication remains unknown; the menisci may compress synovial fluid into the articular cartilage, which reduces frictional forces during weightbearing.13
There is a system of microcanals within the meniscus located close to the blood vessels, which communicates with the synovial cavity; these may provide fluid transport for nutrition and joint lubrication.23,24
Proprioception
The perception of joint motion and position (proprioception) is mediated by mechanoreceptors that transduce mechanical deformation into electric neural signals. Mechanoreceptors have been identified in the anterior and posterior horns of the menisci.*** Quick-adapting mechanoreceptors, such as Pacinian corpuscles, are thought to mediate the sensation of joint motion, and slow-adapting receptors, such as Ruffini endings and Golgi tendon organs, are believed to mediate the sensation of joint position.140 The identification of these neural elements (located mostly in the middle and outer third of the meniscus) indicates that the menisci are capable of detecting proprioceptive information in the knee joint, thus playing an important afferent role in the sensory feedback mechanism of the knee.61,88,90,158,169
Maturation and Aging of The Meniscus
The microanatomy of the meniscus is complex and certainly demonstrates senescent changes. With advancing age, the meniscus becomes stiffer, loses elasticity, and becomes yellow.78,95 Microscopically, there is a gradual loss of cellular elements with empty spaces and an increase in fibrous tissue in comparison with elastic tissue.74 These cystic areas can initiate a tear, and with a torsional force by the femoral condyle, the superficial layers of the meniscus may shear off from the deep layer at the interface of the cystic degenerative change, producing a horizontal cleavage tear. Shear between these layers may cause pain. The torn meniscus may directly injure the overlying articular cartilage.74,95
Ghosh and Taylor found that collagen concentration increased from birth to 30 years and remained constant until 80 years of age, after which a decline occurred.58 The noncollagenous matrix proteins showed the most profound changes, decreasing from 21.9% � 1.0% (dry weight) in neonates to 8.1% � 0.8% between the ages of 30 to 70 years.80 After 70 years of age, the noncollagenous matrix protein levels increased to 11.6% � 1.3%. Peters and Smillie observed an increase in hexosamine and uronic acid with age.131
McNicol and Roughley studied the variation of meniscal proteoglycans in aging113; small differences in extractability and hydrodynamic size were observed. The proportions of keratin sulfate relative to chondroitin-6-sulfate increased with aging.146
Petersen and Tillmann immunohistochemically investigated human menisci (ranging from 22 weeks of gestation to 80 years), observing the differentiation of blood vessels and lymphatics in 20 human cadavers. At the time of birth, nearly the entire meniscus was vascularized. In the second year of life, an avascular area developed in the inner circumference. In the second decade, blood vessels were present in the peripheral third. After 50 years of age, only the peripheral quarter of the meniscal base was vascularized. The dense connective tissue of the insertion was vascularized but not the fibrocartilage of the insertion. Blood vessels were accompanied by lymphatics in all areas.���
Arnoczky suggested that body weight and knee joint motion may eliminate blood vessels in the inner and middle aspects of the menisci.9 Nutrition of meniscal tissue occurs via perfusion from blood vessels and via diffusion from synovial fluid. A requirement for nutrition via diffusion is the intermittent loading and release on the articular surfaces, stressed by body weight and muscle forces.130 The mechanism is comparable with the nutrition of articular cartilage.22
Magnetic Resonance Imaging of The Meniscus
Magnetic resonance imaging (MRI) is a noninvasive diagnostic tool used in the evaluation, diagnosis, and monitoring of the menisci. MRI is widely accepted as the optimal imaging modality because of superior soft tissue contrast.
On cross-sectional MRI, the normal meniscus appears as a uniform low-signal (dark) triangular structure (Figure 9). A meniscal tear is identified by the presence of an increased intrameniscal signal that extends to the surface of this structure.
Several studies have evaluated the clinical utility of MRI for meniscal tears. In general, MRI is highly sensitive and specific for tears of the meniscus. The sensitivity of MRI in detecting meniscal tears ranges from 70% to 98%, and the specificity, from 74% to 98%.48,62,105,107,117 The MRI of 1014 patients before an arthroscopic examination had an accuracy of 89% for pathology of the medial meniscus and 88% for the lateral meniscus.48 A meta-analysis of 2000 patients with an MRI and arthroscopic examination found 88% sensitivity and 94% accuracy for meniscal tears.105,107
There have been discrepancies between MRI diagnoses and the pathology identified during arthroscopic examination.��� Justice and Quinn reported discrepancies in the diagnosis of 66 of the 561 patients (12%).86 In a study of 92 patients, discrepancies between the MRI and arthroscopic diagnoses were noted in 22 of the 349 (6%) cases.106 Miller conducted a single-blind prospective study comparing clinical examinations and MRI in 57 knee examinations.117 He found no significant difference in sensitivity between the clinical examination and MRI (80.7% and 73.7%, respectively). Shepard et al assessed the accuracy of MRI in detecting clinically significant lesions of the anterior horn of the meniscus in 947 consecutive knee MRI154 and found a 74% false-positive rate. Increased signal intensity in the anterior horn does not necessarily indicate a clinically significant lesion.154
Conclusions
The menisci of the knee joint are crescent-shaped wedges of fibrocartilage that provide increased stability to the femorotibial articulation, distribute axial load, absorb shock, and provide lubrication to the knee joint. Injuries to the menisci are recognized as a cause of significant musculoskeletal morbidity. Preservation of the menisci is highly dependent on maintaining its distinctive composition and organization.
In conclusion, the knee is the largest and most complex�joint in the human body. However, because the knee can commonly become damaged as a result of an injury and/or condition, it’s essential to understand the anatomy of the knee joint in order for patients to receive proper treatment.� The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Curated by Dr. Alex Jimenez
Additional Topic Discussion: Relieving Knee Pain without Surgery
Knee pain is a well-known symptom which can occur due to a variety of knee injuries and/or conditions, including�sports injuries. The knee is one of the most complex joints in the human body as it is made-up of the intersection of four bones, four ligaments, various tendons, two menisci, and cartilage. According to the American Academy of Family Physicians, the most common causes of knee pain include patellar subluxation, patellar tendinitis or jumper’s knee, and Osgood-Schlatter disease. Although knee pain is most likely to occur in people over 60 years old, knee pain can also occur in children and adolescents. Knee pain can be treated at home following the RICE methods, however, severe knee injuries may require immediate medical attention, including chiropractic care.
1. Adams ME, Hukins DWL. The extracellular matrix of the meniscus. In: Mow VC, Arnoczky SP, Jackson DW, editors. eds. Knee Meniscus: Basic and Clinical Foundations. New York, NY: Raven Press; 1992:15-282016
2. Adams ME, McDevitt CA, Ho A, Muir H. Isolation and characterization of high-buoyant-density proteoglycans from semilunar menisci. J Bone Joint Surg Am. 1986;68:55-64 [PubMed]
3. Adams ME, Muir H. The glycosaminoglycans of canine menisci. Biochem J. 1981;197:385-389 [PMC free article][PubMed]
4. Ahmed AM, Burke DL. In-vitro measurement of static pressure distribution in synovial joints: part I. Tibial surface of the knee. J Biomech Eng. 1983;185:290-294 [PubMed]
5. Akgun U, Kogaoglu B, Orhan EK, Baslo MB, Karahan M. Possible reflex pathway between medial meniscus and semi-membranous muscle: an experimental study in rabbits. Knee Surg Sports Traumatol Arthrosc. 2008;16(9):809-814 [PubMed]
6. Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. Molecular Biology of the Cell. 4th ed. Bethesda, MD: National Center for Biotechnology Information; 2002
7. Allen CR, Wong EK, Livesay GA, Sakane M, Fu FH, Woo SL. Importance of the medial meniscus in the anterior cruciate ligament-deficient knee. J Orthop Res. 2000;18(1):109-115 [PubMed]
8. Arnoczky SP. Building a meniscus: biologic considerations. Clin Orthop Relat Res. 1999;367S:244-253[PubMed]
9. Arnoczky SP. Gross and vascular anatomy of the meniscus and its role in meniscal healing, regeneration and remodeling. In: Mow VC, Arnoczky SP, Jackson DW, editors. , eds. Knee Meniscus: Basic and Clinical Foundations. New York, NY: Raven Press; 1992:1-14
10. Arnoczky SP, Adams ME, DeHaven KE, Eyre DR, Mow VC. The meniscus. In: Woo SL-Y, Buckwalter J, editors. , eds. Injury and Repair of Musculoskeletal Soft Tissues. Park Ridge, IL: American Academy of Orthopaedic Surgeons; 1987:487-537
11. Arnoczky SP, Warren RF. Anatomy of the cruciate ligaments. In: Feagin JA, editor. , ed. The Crucial Ligaments. New York, NY: Churchill Livingstone; 1988:179-195
12. Arnoczky SP, Warren RF. Microvasculature of the human meniscus. Am J Sports Med. 1982;10:90-95[PubMed]
13. Arnoczky SP, Warren RF, Spivak JM. Meniscal repair using exogenous fibrin clot: an experimental study in dogs. J Bone Joint Surg Am. 1988;70:1209-1217 [PubMed]
14. Aspden RM, Yarker YE, Hukins DWL. Collagen orientations in the meniscus of the knee joint. J Anat. 1985;140:371. [PMC free article][PubMed]
15. Assimakopoulos AP, Katonis PG, Agapitos MV, Exarchou EI. The innervations of the human meniscus. Clin Orthop Relat Res. 1992;275:232-236 [PubMed]
16. Atencia LJ, McDevitt CA, Nile WB, Sokoloff L. Cartilage content of an immature dog. Connect Tissue Res. 1989;18:235-242 [PubMed]
17. Athanasiou KA, Sanchez-Adams J. Engineering the Knee Meniscus. San Rafael, CA: Morgan & Claypool Publishers; 2009
18. Baratz ME, Fu FH, Mengato R. Meniscal tears: the effect of meniscectomy and of repair on the intraarticular contact areas and stress in the human knee. A preliminary report. Am J Sports Med. 1986;14:270-275 [PubMed]
19. Barrack RL, Skinner HB, Buckley SL. Proprioception in the anterior cruciate deficient knee. Am J Sports Med. 1989;17:1-6 [PubMed]
21. Beaupre A, Choukroun R, Guidouin R, Carneau R, Gerardin H. Knee menisci: correlation between microstructure and biomechanics. Clin Orthop Relat Res. 1986;208:72-75 [PubMed]
22. Benninghoff A. Form und Bau der Gelenkknorpel in ihren Beziehungen zur Funktion. Erste Mitteilung: Die modellierenden und formerhaltenden Faktoren des Knorpelreliefs. Z Anat Entwickl Gesch. 1925;76:4263
23. Bird MDT, Sweet MBE. Canals of the semilunar meniscus: brief report. J Bone Joint Surg Br. 1988;70:839. [PubMed]
24. Bird MDT, Sweet MBE. A system of canals in semilunar menisci. Ann Rheum Dis. 1987;46:670-673 [PMC free article][PubMed]
25. Brantigan OC, Voshell AF. The mechanics of the ligaments and menisci of the knee joint. J Bone Joint Surg Am. 1941;23:44-66
26. Brindle T, Nyland J, Johnson DL. The meniscus: review of basic principles with application to surgery and rehabilitation. J Athl Train. 2001;32(2):160-169 [PMC free article][PubMed]
27. Bullough PG, Munuera L, Murphy J, et al. The strength of the menisci of the knee as it relates to their fine structure. J Bone Joint Surg Br. 1979;52:564-570 [PubMed]
28. Bullough PG, Vosburgh F, Arnoczky SP, et al. The menisci of the knee. In: Insall JN, editor. , ed. Surgery of the Knee. New York, NY: Churchill Livingstone; 1984:135-149
29. Burr DB, Radin EL. Meniscal function and the importance of meniscal regeneration in preventing late medial compartment osteoarthrosis. Clin Orthop Relat Res. 1982;171:121-126 [PubMed]
30. Carney SL, Muir H. The structure and function of cartilage proteoglycans. Physiol Rev. 1988;68:858-910 [PubMed]
31. Clark CR, Ogden JA. Development of the menisci of the human knee joint. J Bone Joint Surg Am. 1983;65:530 [PubMed]
32. Clark FJ, Horsh KW, Bach SM, Larson GF. Contributions of cutaneous and joint receptors to static knee-position sense in man. J Neurophysiol. 1979;42:877-888 [PubMed]
33. Danzig L, Resnik D, Gonsalves M, Akeson WH. Blood supply to the normal and abnormal meniscus of the human knee. Clin Orthop Relat Res. 1983;172:271-276 [PubMed]
34. Davies D, Edwards D. The vascular and nerve supply of the human meniscus. Am R Coll Surg Engl. 1948;2:142-156
35. Day B, Mackenzie WG, Shim SS, Leung G. The vascular and nerve supply of the human meniscus. Arthroscopy. 1985;1:58-62 [PubMed]
36. DeHaven KE. Meniscectomy versus repair: clinical experience. In: Mow VC, Arnoczky SP, Jackson DW, editors. , eds. Knee Meniscus: Basic and Clinical Foundations. New York, NY: Raven Press; 1992:131-139
37. DePalma AF. Diseases of the Knee. Philadelphia, PA: JB Lippincott Co; 1954
38. De Smet AA, Graf BK. Meniscal tears missed on MR imaging: relationship to meniscal tear patterns and anterior cruciate ligament tears. AJR Am J Roentgenol. 1994;162:905-911 [PubMed]
39. De Smet AA, Norris MA, Yandow DR, et al. MR diagnosis of meniscal tears of the knee: importance of high signal in the meniscus that extends to the surface. AJR Am J Roentgenol. 1993;161:101-107[PubMed]
40. Dye SF. Functional morphologic features of the human knee: an evolutionary perspective. Clin Orthop Relat Res. 2003;410:19-24 [PubMed]
41. Dye SF. The knee as a biologic transmission with an envelope of function: a theory. Clin Orthop Relat Res. 1996;325:10-18 [PubMed]
42. Dye SF, Vaupel GL, Dye CC. Conscious neurosensory mapping of the internal structures of the human knee without intraarticular anesthesia. Am J Sports Med. 1998;26(6):773-777 [PubMed]
43. Eyre DR, Koob TJ, Chun LE. Biochemistry of the meniscus: unique profile of collagen types and site dependent variations in composition. Orthop Trans. 1983;8:56
44. Eyre DR, Wu JJ. Collagen of fibrocartilage: a distinctive molecular phenotype in bovine meniscus. FEBS Lett. 1983;158:265. [PubMed]
45. Fairbank TJ. Knee joint changes after meniscectomy. J Bone Joint Surg Br. 1948;30:664-670[PubMed]
46. Fife RS. Identification of the link proteins and a 116,000-dalton matrix protein in canine meniscus. Arch Biochem Biophys. 1985;240:682. [PubMed]
47. Fife RS, Hook GL, Brandt KD. Topographic localization of a 116,000 dalton protein in cartilage. J Histochem Cytochem. 1985;33:127. [PubMed]
48. Fischer SP, Fox JM, Del Pizzo W, et al. Accuracy of diagnoses from magnetic resonance imaging of the knee: a multi-center analysis of one thousand and fourteen patients. J Bone Joint Surg Am. 1991;73:2-10[PubMed]
49. Fithian DC, Kelly MA, Mow VC. Material properties and structure-function relationships in the menisci. Clin Orthop Relat Res. 1990;252:19-31 [PubMed]
50. Fukubayashi T, Kurosawa H. The contact area and pressure distribution pattern of the knee: a study of normal and osteoarthritic knee joints. Acta Orthop Scand. 1980;51:871-879 [PubMed]
51. Fukubayashi T, Torzilli PA, Sherman MF, Warren RF. An in vivo biomechanical analysis of anterior-posterior motion of the knee, tibial displacement rotation and torque. J Bone Joint Surg Am. 1982;64:258-264 [PubMed]
52. Gardner E. The innervations of the knee joint. Anat Rec. 1948;101:109-130 [PubMed]
53. Gardner E, O�Rahilly R. The early development of the knee joint in staged human embryos. J Anat. 1968;102:289-299 [PMC free article][PubMed]
54. Ghadially FN, LaLonde JMA. Intramatrical lipidic debris and calcified bodes in human semilunar cartilages. J Anat. 1981;132:481. [PMC free article][PubMed]
55. Ghadially FN, LaLonde JMA, Wedge JH. Ultrastructure of normal and torn menisci of the human knee joint. J Anat. 1983;136:773-791 [PMC free article][PubMed]
56. Ghadially FN, Thomas I, Yong N, LaLonde JMA. Ultrastructure of rabbit semilunar cartilage. J Anat. 1978;125:499. [PMC free article][PubMed]
57. Ghosh P, Ingman AM, Taylor TK. Variations in collagen, non-collagenous proteins, and hexosamine in menisci derived from osteoarthritic and rheumatoid arthritic knee joints. J Rheumatol. 1975;2:100-107[PubMed]
58. Ghosh P, Taylor TKF. The knee joint meniscus: a fibrocartilage of some distinction. Clin Orthop Relat Res. 1987;224:52-63 [PubMed]
59. Ghosh P, Taylor TKF, Pettit GD, Horsburgh BA, Bellenger CR. Effect of postoperative immobilization on the regrowth of knee joint semilunar cartilage: an experimental study. J Orthop Res. 1983;1:153.[PubMed]
60. Gray DJ, Gardner E. Pre-natal development of the human knee and superior tibial fibula joints. Am J Anat. 1950;86:235-288 [PubMed]
61. Gray JC. Neural and vascular anatomy of the menisci of the human knee. J Orthop Sports Phys Ther. 1999;29(1):23-30 [PubMed]
62. Gray SD, Kaplan PA, Dussault RG. Imaging of the knee: current status. Orthop Clin North Am. 1997;28:643-658 [PubMed]
63. Greis PE, Bardana DD, Holmstrom MC, Burks RT. Meniscal injury: I. Basic science and evaluation. J Am Acad Orthop Surg. 2002;10:168-176 [PubMed]
64. Gronblad M, Korkala O, Liesi P, Karaharju E. Innervation of synovial membrane and meniscus. Acta Orthop Scand. 1985;56:484-486 [PubMed]
65. Habuchi H, Yamagata T, Iwata H, Suzuki S. The occurrence of a wide variety of dermatan sulfate-chondroitin sulfate copolymers in fibrous cartilage. J Biol Chem. 1973;248:6019-6028 [PubMed]
67. Hardingham TE, Muir H. Binding of oligosaccharides of hyaluronic acid to proteoglycans. Biochem J. 1973;135 (4):905-908 [PMC free article][PubMed]
68. Harner CD, Janaushek MA, Kanamori A, Yagi AKM, Vogrin TM, Woo SL. Biomechanical analysis of a double-bundle posterior cruciate ligament reconstruction. Am J Sports Med. 2000;28:144-151 [PubMed]
69. Harner CD, Kusayama T, Carlin G, et al. Structural and mechanical properties of the human posterior cruciate ligament and meniscofemoral ligaments. In: Transactions of the 40th Annual Meeting of the Orthopaedic Research Society; 1992
70. Harner CD, Livesgay GA, Choi NY, et al. Evaluation of the sizes and shapes of the human anterior and posterior cruciate ligaments: a comparative study. Trans Orthop Res Soc. 1992;17:123
71. Hascall VC. Interaction of cartilage proteoglycans with hyaluronic acid. J Supramol Struct. 1977;7:101-120 [PubMed]
72. Hascall VC, Heineg�rd D. Aggregation of cartilage proteoglycans: I. The role of hyaluronic acid. J Biol Chem. 1974;249(13):4205-4256 [PubMed]
73. Heinegard D, Oldberg A. Structure and biology of cartilage and bone matrix noncollagenous macromolecules. FASEB J. 1989;3:2042-2051 [PubMed]
74. Helfet AJ. Osteoarthritis of the knee and its early arrest. Instr Course Lect. 1971;20:219-230
75. Heller L, Langman J. The meniscofemoral ligaments of the human knee. J Bone Joing Surg Br. 1964;46:307-313 [PubMed]
76. Henning CE, Lynch MA, Clark JR. Vascularity for healing of meniscal repairs. Arthroscopy. 1987;3:13-18 [PubMed]
77. Herwig J, Egner E, Buddecke E. Chemical changes of human knee joint menisci in various stages of degeneration. Ann Rheum Dis. 1984;43:635-640 [PMC free article][PubMed]
78. H�pker WW, Angres G, Klingel K, Komitowksi D, Schuchardt E. Changes of the elastin compartment in the human meniscus. Virchows Arch A Pathol Anat Histopathol. 1986;408:575-592 [PubMed]
79. Humphry GM. A Treatise on the Human Skeleton Including the Joints. Cambridge, UK: Macmillan; 1858:545-546
80. Ingman AM, Ghosh P, Taylor TKF. Variation of collagenous and non-collagenous proteins of human knee joint menisci with age and degeneration. Gerontologia. 1974;20:212-233 [PubMed]
81. Jerosch J, Prymka M, Castro WH. Proprioception of the knee joints with a lesion of the medial meniscus. Acta Orthop Belg. 1996;62(1):41-45 [PubMed]
82. Johnson DL, Swenson TD, Harner CD. Arthroscopic meniscal transplantation: anatomic and technical considerations. Presented at: Nineteenth Annual Meeting of the American Orthopaedic Society for Sports Medicine; July 12-14, 1993; Sun Valley, ID
83. Johnson DL, Swenson TM, Livesay GA, Aizawa H, Fu FH, Harner CD. Insertion-site anatomy of the human menisci: gross, arthroscopic, and topographical anatomy as a basis for meniscal transplantation. Arthroscopy. 1995;11:386-394 [PubMed]
84. Johnson RJ, Pope MH. Functional anatomy of the meniscus. In: Symposium on Reconstruction of the Knee of the American Academy of Orthopaedic Surgeons. St Louis, MO: Mosby; 1978:3
85. Jones RE, Smith EC, Reisch JS. Effects of medial meniscectomy in patients older than forty years. J Bone Joint Surg Am. 1978;60:783-786 [PubMed]
86. Justice WW, Quinn SF. Error patterns in the MR imaging evaluation of the menisci of the knee. Radiology. 1995;196:617-621 [PubMed]
87. Kaplan EB. The embryology of the menisci of the knee joint. Bull Hosp Joint Dis. 1955;6:111-124[PubMed]
88. Karahan M, Kocaoglu B, Cabukoglu C, Akgun U, Nuran R. Effect of partial medial meniscectomy on the proprioceptive function of the knee. Arch Orthop Trauma Surg. 2010;130:427-431 [PubMed]
89. Kempson GE, Tuke MA, Dingle JT, Barrett AJ, Horsfield PH. The effects of proteolytic enzymes on the mechanical properties of adult human articular cartilage. Biochim Biophys Acta. 1976;428(3):741-760[PubMed]
90. Kennedy JC, Alexander IJ, Hayes KC. Nerve supply of the human knee and its functional importance. Am J Sports Med. 1982;10:329-335 [PubMed]
91. Kettelkamp DB, Jacobs AW. Tibiofemoral contact area: determination and implications. J Bone Joint Surg Am. 1972;54:349-356 [PubMed]
92. King D. The function of the semilunar cartilages. J Bone Joint Surg Br. 1936;18:1069-1076
93. Kohn D, Moreno B. Meniscus insertion anatomy as a basis for meniscus replacement: a morphological cadaveric study. Arthroscopy. 1995;11:96-103 [PubMed]
94. Krause WR, Pope MH, Johnson RJ, Wilder DG. Mechanical changes in the knee after meniscectomy. J Bone Joint Surg Am. 1976;58:599-604 [PubMed]
95. Kulkarni VV, Chand K. Pathological anatomy of the aging meniscus. Acta Orthop Scand. 1975;46:135-140 [PubMed]
96. Kurosawa H, Fukubayashi T, Nakajima H. Load-bearing mode of the knee joint: physical behavior of the knee joint with or without menisci. Clin Orthop Relat Res. 1980;149:283-290 [PubMed]
97. LaPrade RF, Burnett QM, II, Veenstra MA, et al. The prevalence of abnormal magnetic resonance imaging findings in asymptomatic knees: with correlation of magnetic resonance imaging to arthroscopic finding in symptomatic knees. Am J Sports Med. 1994;22:739-745 [PubMed]
98. Last RJ. Some anatomical details of the knee joint. J Bone Joint Surg Br. 1948;30:368-688 [PubMed]
99. Lehtonen A, Viljanto J, K�rkk�inen J. The mucopolysaccharides of herniated human intervertebral discs and semilunar cartilages. Acta Chir Scand. 1967;133(4):303-306 [PubMed]
100. Levy IM, Torzilli PA, Warren RF. The effect of lateral meniscectomy on motion of the knee. J Bone Joint Surg Am. 1989;71:401-406 [PubMed]
101. Levy IM, Torzilli PA, Warren RF. The effect of medial meniscectomy on anterior-posterior motion of the knee. J Bone Joint Surg Am. 1982;64:883-888 [PubMed]
102. MacConaill MA. The function of intra-articular fibrocartilages with special reference to the knee and inferior radio-ulnar joints. J Anat. 1932;6:210-227 [PMC free article][PubMed]
103. MacConaill MA. The movements of bones and joints: III. The synovial fluid and its assistants. J Bone Joint Surg Br. 1950;32:244. [PubMed]
104. MacConaill MA. Studies in the mechanics of synovial joints: II. Displacements on articular surfaces and the significance of saddle joints. Ir J Med Sci. 1946;6:223-235 [PubMed]
105. Mackenzie R, Dixon AK, Keene GS, et al. Magnetic resonance imaging of the knee: assessment of effectiveness. Clin Radiol. 1996;41:245-250 [PubMed]
106. Mackenzie R, Keene GS, Lomas DJ, Dixon AK. Errors at knee magnetic resonance imaging: true or false?Br J Radiol. 1995;68:1045-1051 [PubMed]
107. Mackenzie R, Palmer CR, Lomas DJ, et al. Magnetic resonance imaging of the knee: diagnostic performance studies. Clin Radiol. 1996;51:251-257 [PubMed]
108. Markolf KL, Bargar WL, Shoemaker SC, Amstutz HC. The role of joint load in knee instability. J Bone Joint Surg Am. 1981;63:570-585 [PubMed]
109. Markolf KL, Mensch JS, Amstutz HC. Stiffness and laxity of the knee: the contributions of the supporting structures. J Bone Joint Surg Am. 1976;58:583-597 [PubMed]
110. McDermott LJ. Development of the human knee joint. Arch Surg. 1943;46:705-719
111. McDevitt CA, Miller RR, Sprindler KP. The cells and cell matrix interaction of the meniscus. In: Mow VC, Arnoczky SP, Jackson DW, editors. , eds. Knee Meniscus: Basic and Clinical Foundations. New York, NY: Raven Press; 1992:29-36
112. McDevitt CA, Webber RJ. Ultrastructure and biochemistry of meniscal cartilage. Clin Orthop Relat Res. 1990;252:8-18 [PubMed]
113. McNicol D, Roughley PJ. Extraction and characterization of proteoglycan from human meniscus. Biochem J. 1980;185:705. [PMC free article][PubMed]
114. Merkel KHH. The surface of human menisci and its aging alterations during age: a combined scanning and transmission electron microscopic examination (SEM, TEM). Arch Orthop Trauma Surg. 1980;97:185-191 [PubMed]
115. Messner K, Gao J. The menisci of the knee joint: anatomical and functional characteristics, and a rationale for clinical treatment. J Anat. 1998;193:161-178 [PMC free article][PubMed]
116. Meyers E, Zhu W, Mow V. Viscoelastic properties of articular cartilage and meniscus. In: Nimni M, editor. , ed. Collagen: Chemistry, Biology and Biotechnology. Boca Raton, FL: CRC; 1988
117. Miller GK. A prospective study comparing the accuracy of the clinical diagnosis of meniscal tear with magnetic resonance imaging and its effect on clinical outcome. Arthroscopy. 1996;12:406-413 [PubMed]
118. Miller GK, McDevitt CA. The presence of thrombospondin in ligament, meniscus and intervertebral disc. Glycoconjugate J. 1988;5:312
119. Mossman DJ, Sargeant WAS. The footprints of extinct animals. Sci Am. 1983;250:78-79
120. Mow V, Fithian D, Kelly M. Fundamentals of articular cartilage and meniscus biomechanics. In: Ewing JW, editor. , ed. Articular Cartilage and Knee Joint Function: Basic Science and Arthroscopy. New York, NY: Raven Press; 1989:1-18
121. Mow VC, Holmes MH, Lai WM. Fluid transport and mechanical properties or articular cartilage: a review. J Biomech. 1984;17:377. [PubMed]
122. Muir H. The structure and metabolism of mucopolysaccharides (glycosaminoglycans) and the problem of the mucopolysaccharidoses. Am J Med. 1969;47 (5):673-690 [PubMed]
123. Musahl V, Citak M, O�Loughlin PF, Choi D, Bedi A, Pearle AD. The effect of medial versus lateral meniscectomy on the stability of the anterior cruciate ligament-deficient knee. Am J Sports Med. 2010;38(8):1591-1597 [PubMed]
124. Nakano T, Dodd CM, Scott PG. Glycosaminoglycans and proteoglycans from different zones of the porcine knee meniscus. J Orthop Res. 1997;15:213-222 [PubMed]
125. Newton RA. Joint receptor contributions to reflective and kinaesthetic responses. Phys Ther. 1982;62:22-29 [PubMed]
126. O�Connor BL. The histological structure of the dog knee menisci with comments on its possible significance. Am J Anat. 1976;147:407-417 [PubMed]
127. O�Connor BL, McConnaughey JS. The structure and innervation of cat knee menisci, and their relation to a �sensory hypothesis� of meniscal function. Am J Anat. 1978;153:431-442 [PubMed]
128. Oretorp N, Gillquist J, Liljedahl S-O. Long term results of surgery for non-acute anteromedial rotatory instability of the knee. Acta Orthop Scand. 1979;50:329-336 [PubMed]
129. Pagnani MJ, Warren RF, Arnoczky SP, Wickiewicz TL. Anatomy of the knee. In: Nicholas JA, Hershman EB, editors. , eds. The Lower Extremity and Spine in Sports Medicine. 2nd ed. St Louis, MO: Mosby; 1995:581-614
130. Pauwels F. [Developmental effects of the functional adaptation of bone]. Anat Anz. 1976;139:213-220[PubMed]
131. Peters TJ, Smillie IS. Studies on the chemical composition of the menisci of the knee joint with special reference to the horizontal cleavage lesion. Clin Orthop Relat Res. 1972;86:245-252 [PubMed]
132. Petersen W, Tillmann B. Collagenous fibril texture of the human knee joint menisci. Anat Embryol (Berl). 1998;197:317-324 [PubMed]
133. Poynton AR, Javadpour SM, Finegan PJ, O�Brien M. The meniscofemoral ligaments of the knee. J Bone Joint Surg Br. 1997;79:327-330 [PubMed]
134. Preuschoft H, Tardieu C. Biomechanical reasons for divergent morphology of the knee joint and the distal epiphyseal suture in hominoids. Folia Primatol (Basel). 1996;66:82-92 [PubMed]
135. Proctor CS, Schmidt MB, Whipple RR, Kelly MA, Mow VC. Material properties of the normal medial bovine meniscus. J Orthop Res. 1989;7:771-782 [PubMed]
136. Proske U, Schaible H, Schmidt RF. Joint receptors and kinanesthesia. Exp Brain Res. 1988;72:219-224 [PubMed]
137. Radin EL, de Lamotte F, Maquet P. Role of the menisci in the distribution of stress in the knee. Clin Orthop Relat Res. 1984;185:290-294 [PubMed]
138. Radin EL, Rose RM. Role of subchondral bone in the initiation and progression of cartilage damage. Clin Orthop Relat Res. 1986;213:34-40 [PubMed]
139. Raszeja F. Untersuchungen Bber Entstehung und feinen Bau des Kniegelenkmeniskus. Bruns Beitr klin Chir. 1938;167:371-387
140. Reider B, Arcand MA, Diehl LH, et al. Proprioception of the knee before and after anterior cruciate ligament reconstruction. Arthroscopy. 2003;19(1):2-12 [PubMed]
141. Renstrom P, Johnson RJ. Anatomy and biomechanics of the menisci. Clin Sports Med. 1990;9:523-538 [PubMed]
142. Retterer E. De la forme et des connexions que presentment les fibro-cartilages du genou chez quelques singes d�Afrique. Cr Soc Biol. 1907;63:20-25
143. Ricklin P, Ruttimann A, Del Bouno MS. Diagnosis, Differential Diagnosis and Therapy. 2nd ed. Stuttgart, Germany: Verlag Georg Thieme; 1983
144. Rodkey WG. Basic biology of the meniscus and response to injury. In: Price CT, editor. , ed. Instructional Course Lectures 2000. Rosemont, IL: American Academy of Orthopaedic Surgeons; 2000:189-193 [PubMed]
145. Rosenberg LC, Buckwalter JA, Coutts R, Hunziker E, Mow VC. Articular cartilage. In: Woo SLY, Buckwalter JA, editors. , eds. Injury and Repair of the Musculoskeletal Soft Tissues. Park Ridge, IL: American Academy of Orthopaedic Surgeon; 1988:401
146. Roughley PJ. Changes in cartilage proteoglycan structure during aging: origin and effects: a review. Agents Actions. 1986;518:19 [PubMed]
147. Saygi B, Yildirim Y, Berker N, Ofluoglu D, Karadag-Saygi E, Karahan M. Evaluation of neurosensory function of the medial meniscus in humans. Arthroscopy. 2005;21(12):1468-1472 [PubMed]
148. Scapinelli R. Studies on the vasculature of the human knee joint. Acta Anat. 1968;70:305-331[PubMed]
149. Schutte MJ, Dabezius EJ, Zimny ML, Happe LT. Neural anatomy of the human anterior cruciate ligament. J Bone Joint Surg Am. 1987;69:243-247 [PubMed]
150. Scott JE. Supramolecular organization of extracellular matrix glycosaminoglycans, in vitro and in the tissues. FASEB J. 1992;6:2639-2645 [PubMed]
151. Scott PG, Nakano T, Dodd CM. Isolation and characterization of small proteoglycans from different zones of the porcine knee meniscus. Biochim Biophys Acta. 1997;1336:254-262 [PubMed]
152. Seedhom BB. Loadbearing function of the menisci. Physiotherapy. 1976;62(7):223. [PubMed]
153. Seedhom BB, Hargreaves DJ. Transmission of the load in the knee joint with special reference to the role in the menisci: part II. Experimental results, discussion and conclusion. Eng Med. 1979;8:220-228
154. Shepard MF, Hunter DM, Davies MR, Shapiro MS, Seeger LL. The clinical significance of anterior horn meniscal tears diagnosed on magnetic resonance images. Am J Sports Med. 2002;30(2):189-192[PubMed]
155. Shoemaker SC, Markolf KL. The role of the meniscus in the anterior-posterior stability of the loaded anterior cruciate-deficient knee: effects of partial versus total excision. J Bone Joint Surg Am. 1986;68(1):71-79 [PubMed]
156. Skaags DL, Mow VC. Function of the radial tie fibers in the meniscus. Trans Orthop Res Soc. 1990;15:248
157. Skinner HB, Barrack RL. Joint position sense in the normal and pathologic knee joint. J Electromyogr Kinesiol. 1991;1(3):180-190 [PubMed]
159. Solheim K. Glycosaminoglycans, hydroxyproline, calcium, and phosphorus in healing fractures. Acta Univ Lund. 1965;28:1-22
160. Spilker RL, Donzelli PS. A biphasic finite element model of the meniscus for stress-strain analysis. In: Mow VC, Arnoczky SP, Jackson DW, editors. , eds. Knee Meniscus: Basic and Clinical Foundations. New York, NY: Raven Press; 1992:91-106
161. Spilker RL, Donzelli PS, Mow VC. A transversely isotropic biphasic finite element model of the meniscus. J Biomechanics. 1992;25:1027-1045 [PubMed]
162. Sutton JB. Ligaments: Their Nature and Morphology. 2nd ed. London: HK Lewis; 1897
163. Tardieu C. Ontogeny and phylogeny of femoral-tibial characters in humans and hominid fossils: functional influence and genetic determinism. Am J Phys Anthropol. 1999;110:365-377 [PubMed]
164. Tardieu C, Dupont JY. The origin of femoral trochlear dysplasia: comparative anatomy, evolution, and growth of the patellofemoral joint. Rev Chir Orthop Reparatrice Appar Mot. 2001;87:373-383 [PubMed]
165. Thompson WO, Thaete FL, Fu FH, Dye SF. Tibial meniscal dynamics using three-dimensional reconstruction of magnetic resonance imaging. Am J Sports Med. 1991;19:210-216 [PubMed]
166. Tissakht M, Ahmed AM. Tensile stress-strain characteristics of the human meniscal material. J Biomech. 1995;28:411-422 [PubMed]
167. Tobler T. Zur normalen und pathologischen Histologie des Kniegelenkmeniscus. Arch Klin Chir. 1933;177:483-495
168. Vallois H. Etude anatomique de l�articulation du genou chez les primates. Montpelier, France: L�Abeille; 1914
169. Verdonk R, Aagaard H. Function of the normal meniscus and consequences of the meniscal resection. Scand J Med Sci Sports. 1999;9(3):134-140 [PubMed]
170. Voloshin AS, Wosk J. Shock absorption of meniscectomized and painful knees: a comparative in vivo study. J Biomed Eng. 1983;5:157-161 [PubMed]
171. Wagner H-J. Die kollagenfaserarchitecktur der menisken des menschlichen kniegelenkes. Z Mikrosk Anat Forsch. 1976;90:302. [PubMed]
172. Walker PS, Erkman MJ. The role of the meniscus in force transmission across the knee. Clin Orthop Relat Res. 1975;109:184-192 [PubMed]
173. Wan ACT, Felle P. The menisco-femoral ligaments. Clin Anat. 1995;8:323-326 [PubMed]
174. Warren PJ, Olanlokun TK, Cobb AG, Bentley G. Proprioception after knee arthroplasty: the influence of prosthetic design. Clin Orthop Relat Res. 1993;297:182-187 [PubMed]
175. Warren RF, Arnoczky SP, Wickiewiez TL. Anatomy of the knee. In: Nicholas JA, Hershman EB, editors. , eds. The Lower Extremity and Spine in Sports Medicine. St Louis: Mosby; 1986:657-694
176. Watanabe AT, Carter BC, Teitelbaum GP, et al. Common pitfalls in magnetic resonance imaging of the knee. J Bone Joint Surg Am. 1989;71:857-862 [PubMed]
177. Webber RJ, Norby DP, Malemud CJ, Goldberg VM, Moskowitz RW. Characterization of newly synthesized proteoglycans from rabbit menisci in organ culture. Biochem J. 1984;221(3):875-884 [PMC free article][PubMed]
178. Webber RJ, York JL, Vanderschildren JL, Hough AJ. An organ culture model for assaying wound repair of the fibrocartilaginous knee joint meniscus. Am J Sports Med. 1989;17:393-400 [PubMed]
179. Wilson AS, Legg PG, McNeu JC. Studies on the innervations of the medial meniscus in the human knee joint. Anat Rec. 1969;165:485-492 [PubMed]
180. Wirth CJ. The meniscus: structure, morphology and function. Knee. 1996;3:57-58
181. Wu JJ, Eyre DR, Slayter HS. Type VI collagen of the intervertebral disc: biochemical and electron microscopic characterization of the native protein. Biochem J. 1987;248:373. [PMC free article][PubMed]
182. Yasui K. Three dimensional architecture of normal human menisci. J Jpn Ortho Assoc. 1978;52:391
183. Zimny ML. Mechanoreceptors in articular tissues. Am J Anat. 1988;64:883-888
184. Zimny ML, Albright DJ, Dabezies E. Mechanoreceptors in the human medial meniscus. Acta Anat. 1988;133:35-40 [PubMed]
185. Zivanovic S. Menisco-meniscal ligaments of the human knee joint. Anat Anz. 1974;145:35-42[PubMed]
The knee is the largest joint in the human body, where the complex structures of the lower and upper legs come together. Consisting of three bones, the femur, the tibia, and the patella which are surrounded by a variety of soft tissues, including cartilage, tendons and ligaments, the knee functions as a hinge, allowing you to walk, jump, squat or sit. As a result, however, the knee is considered to be one of the joints that are most prone to suffer injury. A knee injury is the prevalent cause of knee pain.
A knee injury can occur as a result of a direct impact from a slip-and-fall accident or automobile accident, overuse injury from sports injuries, or even due to underlying conditions, such as arthritis. Knee pain is a common symptom which affects people of all ages. It may also start suddenly or develop gradually over time, beginning as a mild or moderate discomfort then slowly worsening as time progresses. Moreover, being overweight can increase the risk of knee problems. The purpose of the following article is to discuss the evaluation of patients presenting with knee pain and demonstrate their differential diagnosis.
Abstract
Knee pain is a common presenting complaint with many possible causes. An awareness of certain patterns can help the family physician identify the underlying cause more efficiently. Teenage girls and young women are more likely to have patellar tracking problems such as patellar subluxation and patellofemoral pain syndrome, whereas teenage boys and young men are more likely to have knee extensor mechanism problems such as tibial apophysitis (Osgood-Schlatter lesion) and patellar tendonitis. Referred pain resulting from hip joint pathology, such as slipped capital femoral epiphysis, also may cause knee pain. Active patients are more likely to have acute ligamentous sprains and overuse injuries such as pes anserine bursitis and medial plica syndrome. Trauma may result in acute ligamentous rupture or fracture, leading to acute knee joint swelling and hemarthrosis. Septic arthritis may develop in patients of any age, but crystal-induced inflammatory arthropathy is more likely in adults. Osteoarthritis of the knee joint is common in older adults. (Am Fam Physician 2003;68:917-22. Copyright� 2003 American Academy of Family Physicians.)
Introduction
Determining the underlying cause of knee pain can be difficult, in part because of the extensive differential diagnosis. As discussed in part I of this two-part article,1 the family physician should be familiar with knee anatomy and common mechanisms of injury, and a detailed history and focused physical examination can narrow possible causes. The patient�s age and the anatomic site of the pain are two factors that can be important in achieving an accurate diagnosis (Tables 1 and 2). �
�
�
Children and Adolescents
Children and adolescents who present with knee pain are likely to have one of three common conditions: patellar subluxation, tibial apophysitis, or patellar tendonitis. Additional diagnoses to consider in children include slipped capital femoral epiphysis and septic arthritis.
Patellar Subluxation
Patellar subluxation is the most likely diagnosis in a teenage girl who presents with giving-way episodes of the knee.2 This injury occurs more often in girls and young women because of an increased quadriceps angle (Q angle), usually greater than 15 degrees.
Patellar apprehension is elicited by subluxing the patella laterally, and a mild effusion is usually present. Moderate to severe knee swelling may indicate hemarthrosis, which suggests patellar dislocation with osteochondral fracture and bleeding.
Tibial Apophysitis
A teenage boy who presents with anterior knee pain localized to the tibial tuberosity is likely to have tibial apophysitis or Osgood- Schlatter lesion3,4 (Figure 1).5 The typical patient is a 13- or 14-year-old boy (or a 10- or 11-year-old girl) who has recently gone through a growth spurt.
The patient with tibial apophysitis generally reports waxing and waning of knee pain for a period of months. The pain worsens with�squatting, walking up or down stairs, or forceful contractions of the quadriceps muscle. This overuse apophysitis is exacerbated by jumping and hurdling because repetitive hard landings place excessive stress on the insertion of the patellar tendon.
On physical examination, the tibial tuberosity is tender and swollen and may feel warm. The knee pain is reproduced with the resisted active extension or passive hyperflexion of the knee. No effusion is present. Radiographs are usually negative; rarely, they show avulsion of the apophysis at the tibial tuberosity. However, the physician must not mistake the normal appearance of the tibial apophysis for an avulsion fracture. �
�
�
�
Patellar Tendonitis
Jumper�s knee (irritation and inflammation of the patellar tendon) most commonly occurs in teenage boys, particularly during a growth spurt2 (Figure 1).5 The patient reports vague anterior knee pain that has persisted for months and worsens after activities such as walking down stairs or running.
On physical examination, the patellar tendon is tender, and the pain is reproduced by resisted knee extension. There is usually no effusion. Radiographs are not indicated.
Slipped Capital Femoral Epiphysis
A number of pathologic conditions result in referral of pain to the knee. For example, the possibility of slipped capital femoral epiphysis must be considered in children and teenagers who present with knee pain.6 The patient with this condition usually reports poorly localized knee pain and no history of knee trauma.
The typical patient with slipped capital femoral epiphysis is overweight and sits on the examination table with the affected hip slightly flexed and externally rotated. The knee examination is normal, but hip pain is elicited with passive internal rotation or extension of the affected hip.
Radiographs typically show displacement of the epiphysis of the femoral head. However, negative radiographs do not rule out the diagnosis in patients with typical clinical findings. Computed tomographic (CT) scanning is indicated in these patients.
Osteochondritis Dissecans
Osteochondritis dissecans is an intra-articular osteochondrosis of unknown etiology that is characterized by degeneration and recalcification of articular cartilage and underlying bone. In the knee, the medial femoral condyle is most commonly affected.7
The patient reports vague, poorly localized knee pain, as well as morning stiffness or recurrent effusion. If a loose body is present, mechanical symptoms of locking or catching of the knee joint also may be reported. On physical examination, the patient may demonstrate quadriceps atrophy or tenderness along the involved chondral surface. A mild joint effusion may be present.7
Plain-film radiographs may demonstrate the osteochondral lesion or a loose body in the knee joint. If osteochondritis dissecans is suspected, recommended radiographs include anteroposterior, posteroanterior tunnel, lateral, and Merchant�s views. Osteochondral lesions at the lateral aspect of the medial femoral condyle may be visible only on the posteroanterior tunnel view. Magnetic resonance imaging (MRI) is highly sensitive in detecting these abnormalities and is indicated in patients with a suspected osteochondral lesion.7 �
�
A knee injury caused by sports injuries, automobile accidents, or an underlying condition, among other causes, can affect the cartilage, tendons and ligaments which form the knee joint itself. The location of the knee pain can differ according to the structure involved, also, the symptoms can vary. The entire knee may become painful and swollen as a result of inflammation or infection, whereas a torn meniscus or fracture may cause symptoms in the affected region. Dr. Alex Jimenez D.C., C.C.S.T. Insight
Adults
Overuse Syndromes
Anterior Knee Pain. Patients with patellofemoral pain syndrome (chondromalacia patellae) typically present with a vague history of mild to moderate anterior knee pain that usually occurs after prolonged periods of sitting (the so-called �theater sign�).8 Patellofemoral pain syndrome is a common cause of anterior knee pain in women.
On physical examination, a slight effusion may be present, along with patellar crepitus on the range of motion. The patient�s pain may be reproduced by applying direct pressure to the anterior aspect of the patella. Patellar tenderness may be elicited by subluxing the patella medially or laterally and palpating the superior and inferior facets of the patella. Radiographs usually are not indicated.
Medial Knee Pain. One frequently overlooked diagnosis is medial plica syndrome. The plica, a redundancy of the joint synovium medially, can become inflamed with repetitive overuse.4,9 The patient presents with acute onset of medial knee pain after a marked increase in usual activities. On physical examination, a tender, mobile nodularity is present at the medial aspect of the knee, just anterior to the joint line. There is no joint effusion, and the remainder of the knee examination is normal. Radiographs are not indicated.
Pes anserine bursitis is another possible cause of medial knee pain. The tendinous insertion of the sartorius, gracilis, and semitendinosus muscles at the anteromedial aspect of the proximal tibia forms the pes anserine bursa.9 The bursa can become inflamed as a result of overuse or a direct contusion. Pes�anserine bursitis can be confused easily with a medial collateral ligament sprain or, less commonly, osteoarthritis of the medial compartment of the knee. �
�
�
The patient with pes anserine bursitis reports pain at the medial aspect of the knee. This pain may be worsened by repetitive flexion and extension. On physical examination, tenderness is present at the medial aspect of the knee, just posterior and distal to the medial joint line. No knee joint effusion is present, but there may be slight swelling at the insertion of the medial hamstring muscles. Valgus stress testing in the supine position or resisted knee flexion in the prone position may reproduce the pain. Radiographs are usually not indicated.
Lateral Knee Pain. Excessive friction between the iliotibial band and the lateral femoral condyle can lead to iliotibial band tendonitis.9 This overuse syndrome commonly occurs in runners and cyclists, although it may develop in any person subsequent to activity involving repetitive knee flexion. The tightness of the iliotibial band, excessive foot pronation, genu varum, and tibial torsion are predisposing factors.
The patient with iliotibial band tendonitis reports pain at the lateral aspect of the knee joint. The pain is aggravated by activity, particularly running downhill and climbing stairs. On physical examination, tenderness is present at the lateral epicondyle of the femur, approximately 3 cm proximal to the joint line. Soft tissue swelling and crepitus also may be present, but there is no joint effusion. Radiographs are not indicated.
Noble�s test is used to reproduce the pain in iliotibial band tendonitis. With the patient in a supine position, the physician places a thumb over the lateral femoral epicondyle as the�patient repeatedly flexes and extends the knee. Pain symptoms are usually most prominent with the knee at 30 degrees of flexion.
Popliteus tendonitis is another possible cause of lateral knee pain. However, this condition is fairly rare.10
Trauma
Anterior Cruciate Ligament Sprain. Injury to the anterior cruciate ligament usually occurs because of noncontact deceleration forces, as when a runner plants one foot and sharply turns in the opposite direction. Resultant valgus stress on the knee leads to anterior displacement of the tibia and sprain or rupture of the ligament.11 The patient usually reports hearing or feeling a �pop� at the time of the injury and must cease activity or competition immediately. Swelling of the knee within two hours after the injury indicates rupture of the ligament and consequent hemarthrosis.
On physical examination, the patient has a moderate to severe joint effusion that limits the range of motion. The anterior drawer test may be positive, but can be negative because of hemarthrosis and guarding by the hamstring muscles. The Lachman test should be positive and is more reliable than the anterior drawer test (see text and Figure 3 in part I of the article1).
Radiographs are indicated to detect possible tibial spine avulsion fracture. MRI of the knee is indicated as part of a presurgical evaluation.
Medial Collateral Ligament Sprain. Injury to the medial collateral ligament is fairly common and is usually the result of acute trauma. The patient reports a misstep or collision that places valgus stress on the knee, followed by the immediate onset of pain and swelling at the medial aspect of the knee.11
On physical examination, the patient with medial collateral ligament injury has point tenderness at the medial joint line. Valgus stress testing of the knee flexed to 30 degrees reproduces the pain (see text and Figure 4 in part I of this article1). A clearly defined endpoint on valgus stress testing indicates a grade 1�or grade 2 sprain, whereas complete medial instability indicates full rupture of the ligament (grade 3 sprain).
Lateral Collateral Ligament Sprain. Injury of the lateral collateral ligament is much less common than the injury of the medial collateral ligament. Lateral collateral ligament sprain usually results from varus stress to the knee, as occurs when a runner plants one foot and then turns toward the ipsilateral knee.2 The patient reports acute onset of lateral knee pain that requires prompt cessation of activity.
On physical examination, point tenderness is present at the lateral joint line. Instability or pain occurs with varus stress testing of the knee flexed to 30 degrees (see text and Figure 4 in part I of this article1). Radiographs are not usually indicated.
Meniscal Tear. The meniscus can be torn acutely with a sudden twisting injury of the knee, such as may occur when a runner suddenly changes direction.11,12 Meniscal tear also may occur in association with a prolonged degenerative process, particularly in a patient with an anterior cruciate ligament-deficient knee. The patient usually reports recurrent knee pain and episodes of catching or locking of the knee joint, especially with squatting or twisting of the knee.
On physical examination, a mild effusion is usually present, and there is tenderness at the medial or lateral joint line. Atrophy of the vastus medialis obliquus portion of the quadriceps muscle also may be noticeable. The McMurray test may be positive (see Figure 5 in part I of this article1), but a negative test does not eliminate the possibility of a meniscal tear.
Plain-film radiographs usually are negative and seldom are indicated. MRI is the radiologic test of choice because it demonstrates most significant meniscal tears.
Infection
Infection of the knee joint may occur in patients of any age but is more common in those whose immune system has been weakened by cancer, diabetes mellitus, alcoholism,�acquired immunodeficiency syndrome, or corticosteroid therapy. The patient with septic arthritis reports abrupt onset of pain and swelling of the knee with no antecedent trauma.13
On physical examination, the knee is warm, swollen, and exquisitely tender. Even slight motion of the knee joint causes intense pain.
Arthrocentesis reveals turbid synovial fluid. Analysis of the fluid yields a white blood cell count (WBC) higher than 50,000 per mm3 (50 ? 109 per L), with more than 75 percent (0.75) polymorphonuclear cells, an elevated protein content (greater than 3 g per dL [30 g per L]), and a low glucose concentration (more than 50 percent lower than the serum glucose concentration).14 Gram stain of the fluid may demonstrate the causative organism. Common pathogens include Staphylococcus aureus, Streptococcus species, Haemophilus influenza, and Neisseria gonorrhoeae.
Hematologic studies show an elevated WBC, an increased number of immature polymorphonuclear cells (i.e., a left shift), and an elevated erythrocyte sedimentation rate (usually greater than 50 mm per hour).
Older Adults
Osteoarthritis
Osteoarthritis of the knee joint is a common problem after 60 years of age. The patient presents with knee pain that is aggravated by weight-bearing activities and relieved by rest.15 The patient has no systemic symptoms but usually awakens with morning stiffness that dissipates somewhat with activity. In addition to chronic joint stiffness and pain, the patient may report episodes of acute synovitis.
Findings on physical examination include decreased range of motion, crepitus, a mild joint effusion, and palpable osteophytic changes at the knee joint.
When osteoarthritis is suspected, recommended radiographs include weight-bearing anteroposterior and posteroanterior tunnel views, as well as non-weight-bearing Merchants and lateral views. Radiographs show�joint-space narrowing, subchondral bony sclerosis, cystic changes, and hypertrophic osteophyte formation.
Crystal-Induced Inflammatory Arthropathy
Acute inflammation, pain, and swelling in the absence of trauma suggest the possibility of a crystal-induced inflammatory arthropathy such as gout or pseudogout.16,17 Gout commonly affects the knee. In this arthropathy, sodium urate crystals precipitate in the knee joint and cause an intense inflammatory response. In pseudogout, calcium pyrophosphate crystals are the causative agents.
On physical examination, the knee joint is erythematous, warm, tender, and swollen. Even minimal range of motion is exquisitely painful.
Arthrocentesis reveals clear or slightly cloudy synovial fluid. Analysis of the fluid yields a WBC count of 2,000 to 75,000 per mm3 (2 to 75 ? 109 per L), a high protein content (greater than 32 g per dL [320 g per L]), and a glucose concentration that is approximately 75 percent of the serum glucose con- centration.14 Polarized-light microscopy of the synovial fluid displays negatively birefringent rods in the patient with gout and positively birefringent rhomboids in the patient with pseudogout.
Popliteal Cyst
The popliteal cyst (Baker�s cyst) is the most common synovial cyst of the knee. It originates from the posteromedial aspect of the knee joint at the level of the gastrocnemio-semimembranous bursa. The patient reports insidious onset of mild to moderate pain in the popliteal area of the knee.
On physical examination, palpable fullness is present at the medial aspect of the popliteal area, at or near the origin of the medial head of the gastrocnemius muscle. The McMurray test may be positive if the medial meniscus is injured. Definitive diagnosis of a popliteal cyst may be made with arthrography, ultrasonography, CT scanning, or, less commonly, MRI.
The authors indicate that they do not have any conflicts of interest. Sources of funding: none reported.
In conclusion, although the knee is the largest joint in the human body where the structures of the lower extremities meet, including the femur, the tibia, the patella, and many other soft tissues, the knee can easily suffer damage or injury and result in knee pain. Knee pain is one of the most common complaints among the general population, however, it commonly occurs in athletes. Sports injuries, slip-and-fall accidents, and automobile accidents, among other causes, can lead to knee pain.
As described in the article above, diagnosis is essential towards determining the best treatment approach for each type of knee injury, according to their underlying cause. While the location and the severity of the knee injury may vary depending on the cause of the health issue, knee pain is the most common symptom. Treatment options, such as chiropractic care and physical therapy, can help treat knee pain. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Curated by Dr. Alex Jimenez �
�
�
Additional Topic Discussion: Relieving Knee Pain without Surgery
�
Knee pain is a well-known symptom which can occur due to a variety of knee injuries and/or conditions, including�sports injuries. The knee is one of the most complex joints in the human body as it is made-up of the intersection of four bones, four ligaments, various tendons, two menisci, and cartilage. According to the American Academy of Family Physicians, the most common causes of knee pain include patellar subluxation, patellar tendinitis or jumper’s knee, and Osgood-Schlatter disease. Although knee pain is most likely to occur in people over 60 years old, knee pain can also occur in children and adolescents. Knee pain can be treated at home following the RICE methods, however, severe knee injuries may require immediate medical attention, including chiropractic care.
1. Calmbach WL, Hutchens M. Evaluation of patients presenting with knee pain: part I. History, physical examination, radiographs, and laboratory tests. Am Fam Physician 2003;68:907-12.
2. Walsh WM. Knee injuries. In: Mellion MB, Walsh WM, Shelton GL, eds. The team physician�s hand- book. 2d ed. St. Louis: Mosby, 1990:554-78.
3. Dunn JF. Osgood-Schlatter disease. Am Fam Physi- cian 1990;41:173-6.
4. Stanitski CL. Anterior knee pain syndromes in the adolescent. Instr Course Lect 1994;43:211-20.
5. Tandeter HB, Shvartzman P, Stevens MA. Acute knee injuries: use of decision rules for selective radiograph ordering. Am Fam Physician 1999;60: 2599-608.
6. Waters PM, Millis MB. Hip and pelvic injuries in the young athlete. In: DeLee J, Drez D, Stanitski CL, eds. Orthopaedic sports medicine: principles and practice. Vol. III. Pediatric and adolescent sports medicine. Philadelphia: Saunders, 1994:279-93.
7. Schenck RC Jr, Goodnight JM. Osteochondritis dis- secans. J Bone Joint Surg [Am] 1996;78:439-56.
8. Ruffin MT 5th, Kiningham RB. Anterior knee pain: the challenge of patellofemoral syndrome. Am Fam Physician 1993;47:185-94.
IFM's Find A Practitioner tool is the largest referral network in Functional Medicine, created to help patients locate Functional Medicine practitioners anywhere in the world. IFM Certified Practitioners are listed first in the search results, given their extensive education in Functional Medicine