Sulforaphane is a phytochemical, a substance within the isothiocyanate group of organosulfur compounds, found in cruciferous vegetables, such as broccoli, cabbage, cauliflower, and Brussels sprouts. It can also be found in bok choy, kale, collards, mustard greens and watercress. Research studies have shown that sulforaphane can help prevent various types of cancer by activating the production of Nrf2, or nuclear factor erythroid 2-related factor, a transcription factor which regulates�protective antioxidant mechanisms that control the cell’s response to oxidants. The purpose of the following article is to describe the function of sulforaphane.
Abstract
The KEAP1-Nrf2-ARE antioxidant system is a principal means by which cells respond to oxidative and xenobiotic stresses. Sulforaphane (SFN), an electrophilic isothiocyanate derived from cruciferous vegetables, activates the KEAP1-Nrf2-ARE pathway and has become a molecule-of-interest in the treatment of diseases in which chronic oxidative stress plays a major etiological role. We demonstrate here that the mitochondria of cultured, human retinal pigment epithelial (RPE-1) cells treated with SFN undergo hyperfusion that is independent of both Nrf2 and its cytoplasmic inhibitor KEAP1. Mitochondrial fusion has been reported to be cytoprotective by inhibiting pore formation in mitochondria during apoptosis, and consistent with this, we show Nrf2-independent, cytoprotection of SFN-treated cells exposed to the apoptosis-inducer, staurosporine. Mechanistically, SFN mitigates the recruitment and/or retention of the soluble fission factor Drp1 to mitochondria and to peroxisomes but does not affect overall Drp1 abundance. These data demonstrate that the beneficial properties of SFN extend beyond the activation of the KEAP1-Nrf2-ARE system and warrant further interrogation given the current use of this agent in multiple clinical trials.
Sulforaphane is an Nrf2-Independent Inhibitor of Mitochondrial Fission
Sulforaphane (SFN) is an isothiocyanate compound derived in the diet most commonly from cruciferous vegetables [56]. It is generated in plants as a xenobiotic response to predation via vesicular release of the hydrolytic enzyme myrosinase from damaged cells; this enzyme converts glucosinolates to isothiocyantes [42]. Over the last two decades, SFN has been extensively characterized for its reported anticancer, antioxidant, and antimicrobial properties [57]. Much of this efficacy has been attributed to the capacity of SFN to modulate the KEAP1-Nrf2-antioxidant response element (ARE) signaling pathway, although additional activities of the compound have been identified, including the inhibition of histone deacetylase activity and cell cycle progression [29]. Nrf2 is the master antioxidant transcription factor and under conditions of homeostasis, its stability is suppressed through the action of the cytoplasmic Cullin3KEAP1 ubiquitin ligase complex [20]. Specifically, Nrf2 is recruited to the Cullin3KEAP1 ligase by binding to the dimeric substrate adaptor KEAP1 and is subsequently modified with polyUb chains that target the transcription factor for proteasome-mediated degradation. This constitutive turnover limits the half-life of Nrf2 in unstressed cells to ~15 min [30], [33], [46], [55]. In response to numerous types of stress, most notably oxidative stress, KEAP1, a cysteine-rich protein, acts as a redox sensor, and oxidative modification of critical cysteines, particularly C151, of KEAP1 dissociates Nrf2-KEAP1 from CUL3 thereby preventing Nrf2 degradation [8], [20], [55]. Notably, SFN, and possibly other Nrf2 activators, mimic oxidative stress by modifying C151 of KEAP1 e.g. [21]. Stabilization of Nrf2 allows for its translocation to the nucleus where it induces the expression of a battery of Phase II antioxidant and detoxification genes. Nrf2 binds to the antioxidant response promoter elements (ARE) of its cognate target genes through heterodimerization with small Maf proteins [19]. This system presents a dynamic and sensitive response to indirect antioxidants like SFN, free radicals generated by the mitochondria [16], or other physiologic sources of oxidative stress [41].
Mitochondria are dynamic, subcellular organelles that regulate a host of cellular functions ranging from ATP production and intracellular calcium buffering to redox regulation and apoptosis [13], [49]. Mitochondria also represent the principal source of reactive oxygen species (ROS) within the cell. Proper regulation of mitochondrial function is therefore necessary for optimizing ATP production to meet cellular needs while simultaneously minimizing the potentially harmful effects of excessive free radical production. A critical requirement for fine modulation of mitochondrial function is the capacity for mitochondria to function both independently as biochemical machines and as part of a vast, responsive network.
Mitochondrial network morphology and function are determined by a regulated balance between fission and fusion. Mitochondrial fission is required for daughter cell inheritance of mitochondria during cell division [28] as well as for the selective, autophagic degradation of depolarized or damaged mitochondria, termed mitophagy [1]. Conversely, fusion is required for complementation of mitochondrial genomes and sharing of electron transport chain components between neighboring mitochondria [54]. At the molecular level, mitochondrial fission and fusion are regulated by large, dynamin-like GTPases. Three enzymes primarily regulate fusion: Mitofusins 1 and 2 (Mfn1/2) are two-pass outer membrane proteins that mediate outer membrane fusion via heterotypic interactions between adjacent mitochondria [15], [25], [37], while OPA1 is an inner membrane protein that simultaneously ensures matrix connectivity by regulating the melding of inner membranes [5]. The GTPase activity of all three proteins is required for robust fusion [5], [18], and OPA1 is further regulated by complex proteolysis within the mitochondrial inner membrane by the proteases OMA1 [14], PARL [6], and YME1L [45]. Importantly, intact mitochondrial membrane potential is required for efficient fusion in order to suppress integration of damaged and healthy mitochondria [26].
Mitochondrial fission is primarily catalyzed by a cytosolic protein called Dynamin-related protein 1 (Drp1/DNM1L). Drp1 is recruited from the cytosol to prospective sites of fission on the mitochondrial outer membrane [43]. The major receptors for Drp1 on the outer membrane are mitochondrial fission factor (Mff) [32] and, to a lesser extent, Fission 1 (Fis1) [51]. Additionally, a decoy receptor, MIEF1/MiD51, was discovered that acts to further limit the activity of Drp1 protein at potential fission sites [58]. Once docked at the mitochondrial outer membrane, Drp1 oligomerizes into spiral-like structures around the body of the mitochondrion and then utilizes the energy derived from GTP hydrolysis to mediate the physical scission of the mitochondrial outer and inner membranes [17]. Endoplasmic reticulum-derived tubules act as an initial constrictor of mitochondria prior to Drp1 oligomerization, underscoring the revelation that non-constricted mitochondria are wider than the permissive circumference of a completed Drp1 spiral [12]. Actin dynamics are also important for the ER-mitochondria interactions that precede mitochondrial fission [24]. In addition to its role in mitochondrial fission, Drp1 catalyzes the fission of peroxisomes [40].
Drp1 is very similar to the well-characterized dynamin protein in that both proteins contain an N-terminal GTPase domain, a Middle domain that is critical for self-oligomerization, and a C-terminal GTPase effector domain [31]. Drp1 achieves selectivity for mitochondrial membranes through a combination of interactions with its receptor proteins Mff and Fis1 and also through its affinity for the mitochondria-specific phospholipid cardiolipin via the unique B-insert domain of Drp1 [2]. Drp1 typically exists as a homotetramer in the cytoplasm, and higher order assembly at mitochondrial fission sites is mediated by the Middle domain of Drp1 [3].
Given the implicit link between mitochondrial function and the KEAP1-Nrf2-ARE pathway, we investigated the effects of Nrf2 activation on mitochondrial structure and function. We demonstrate here that SFN induces mitochondrial hyperfusion that, unexpectedly, is independent of both Nrf2 and KEAP1. This effect of SFN is through an inhibition of Drp1 function. We further demonstrate that SFN confers resistance to apoptosis that is Nrf2-independent and mimics that observed in cells depleted of Drp1. These data collectively indicate that in addition to stabilizing and activating Nrf2, SFN modulates mitochondrial dynamics and preserves cellular fitness and survival.
Results
Sulforaphane Induces Nrf2/KEAP1-Independent Hyperfusion of Mitochondria
In the course of studying the effects of Nrf2 activation on mitochondrial network dynamics, we discovered that treatment of immortalized, human retinal pigment epithelial (RPE-1) cells with sulforaphane (SFN), a potent activator of Nrf2 signaling, induced a robust fusion of the mitochondrial network when compared with vehicle-treated control cells (Fig. 1A and B). The morphology of the mitochondria in these cells greatly resembled that of the mitochondria in cells depleted by siRNA of endogenous Drp1, the principal mitochondrial fission factor (Fig. 1A). This result raised the intriguing idea that mitochondrial fission and fusion status responds directly to Nrf2 levels in the cell. However, stimulation of cells with other Nrf2 stabilizers and activators such as the proteasome inhibitor MG132, the pro-oxidant tBHQ, or knockdown of the Nrf2 inhibitor KEAP1 did not induce mitochondrial fusion (Fig. 1A and B). Stabilization of Nrf2 by these manipulations was confirmed by western blotting for endogenous Nrf2 (Fig. 1C). Furthermore, expression of Nrf2 was dispensable for SFN-induced mitochondrial fusion, as knockdown of endogenous Nrf2 with siRNA failed to counter this phenotype (Fig. 1D�F). Because SFN stimulates the KEAP1-Nrf2-ARE pathway by covalently modifying cysteine residues of KEAP1 [21], we knocked down KEAP1 to address whether SFN-induced mitochondrial hyperfusion is stimulated through a KEAP1-dependent, but Nrf2 independent pathway. However, depletion of KEAP1 also failed to abrogate SFN-induced mitochondrial fusion (Fig. 1G�I). In fact, SFN reversed the pro-fission morphology induced by depletion of KEAP1 (Fig. 1G, panel b versus panel d). These results indicate that SFN treatment causes mitochondrial fusion independent of the canonical KEAP1-Nrf2-ARE pathway and led us to interrogate whether SFN directly affects components of the mitochondrial fission or fusion machinery.
Figure 1 SFN induces Nrf2/KEAP1-independent mitochondrial fusion. (A) RPE-1 cells were transfected with the indicated siRNAs and 3 days later treated with DMSO or the Nrf2 activators SFN (50 ?M), MG132 (10 ?M), or tBHQ (100 ?M) for 4 h. Mitochondria (red) are labeled with an anti-Tom20 antibody, and nuclei (blue) are counterstained with DAPI. (B) Graph showing quantification of mitochondrial morphology scoring from (A). >50 cells per condition were evaluated in a blinded fashion. (C) Representative western blots from (A). (D) RPE-1 cells were transfected with 10 nM siRNA and 3 days later treated with SFN for 4 h prior to being fixed and stained as in (A). (E) Graph showing quantification of mitochondrial phenotype scoring from (D). >100 cells per condition were evaluated in a blinded fashion. (F) Representative western blots from (D). (G) Cells were transfected and treated as in (D) with siCON or siKEAP1. (H) Cells from (G) were scored as in (B) and (E) on the basis of mitochondrial morphology. (I) Representative western blots from (G). Data in (B), (E), and (H) were compiled from 3 independent experiments each and statistical significance was determined by two-tailed Student’s t-test. Error bars reflect +/- S.D. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).
Sulforaphane Impairs the Mitochondrial Association of Drp1
Based on the finding that SFN-treatment induces mitochondrial hyperfusion, we reasoned that this phenotype was either a consequence of excessive fusion activity or an inhibition of fission activity. To discriminate between these two possibilities, we compared the morphology of peroxisomes in the presence and absence of SFN. Peroxisomes are similar to mitochondria in that they are dynamic organelles the shape and length of which are constantly in flux [44]. Peroxisomes contain both Fis1 and Mff in their outer membrane and, as a consequence, are targets for Drp1-mediated fission [22], [23]. However, peroxisomes do not utilize the fusion machinery of the mitochondrial network and consequently, do not undergo fusion [39]. Rather, peroxisomal fission is opposed by the lengthening of existing peroxisomes via de novo addition of membranes and proteins [44]. Because peroxisomes lack Mfn1/2 and OPA1, we reasoned that if SFN activates the fusion machinery rather than inhibiting the fission machinery, peroxisome length would not be affected. In vehicle-treated cells, peroxisomes are maintained as short, round, punctiform organelles (Fig. 2, panels b and d). However, SFN treatment increased peroxisome length by ~2-fold as compared to control cells (Fig. 2, panels f and h). Furthermore, many of the peroxisomes were pinched near the center, indicating a potential scission defect (Fig. 2, panel h, arrowheads). Likewise, peroxisomes in cells transfected with Drp1 siRNA were abnormally long (Fig. 2, panels j and l), confirming that Drp1 is required for peroxisomal fission and suggesting that SFN-treatment causes mitochondrial and peroxisomal phenotypes by disrupting the fission machinery.
Figure 2 SFN induces peroxisomal lengthening. (A) RPE-1 cells were transfected with 10 nM of the indicated siRNA and 3 days later treated with DMSO or 50 ?M SFN for 4 h. Peroxisomes (green) were labeled with an anti-PMP70 antibody, mitochondria with MitoTracker (red), and DNA counterstained with DAPI. Enlarged insets of peroxisomes are shown on the right (panels d, h, and l) to facilitate visualization of the changes in morphology induced by SFN and Drp1 depletion. Arrowheads highlight constriction points. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).
We next determined how SFN restricts Drp1 function. Possibilities included reductions in expression levels, recruitment/retention at mitochondria, oligomerization, or enzymatic activity of the GTPase. A deficit in any one of these would result in reduced mitochondrial fission and hyperfusion. We did not detect reproducible changes in Drp1 protein levels after SFN-treatment (Figs. 1C and 3A), and therefore concluded that SFN does not alter Drp1 stability or expression, consistent with Drp1 having a half-life of >10 h [50] and our SFN treatments being of shorter duration. Next, we investigated whether SFN affected the recruitment or retention of Drp1 to mitochondria. Fractionation studies showed that SFN induced a loss of Drp1 from the mitochondrial fraction (Fig. 3A, lanes 7�8 and Fig. 3B). As reported previously [43], only a minor fraction of Drp1 (~3%) is associated with the mitochondrial network at any given time during steady state conditions with most of the enzyme residing in the cytoplasm (Fig. 3A, lanes 5�8). These fractionation data were confirmed using co-localization analysis which showed a ~40% reduction in mitochondria-localized, punctate Drp1 foci after SFN-treatment (Fig. 3C and D). Together, these data indicate that the mitochondrial fusion induced by SFN is, at least partially, due to the attenuated association of Drp1 with the mitochondria. Our data do not distinguish between whether SFN interferes with the mitochondrial recruitment versus the mitochondrial retention of Drp1, or both, as the analysis of endogenous Drp1 was not amenable to visualizing the GTPase by live-cell microscopy.
Figure 3 SFN causes a loss of Drp1 from the mitochondria. (A) Subcellular fractionation of RPE-1 cells following 4 h of DMSO or SFN. Whole-cell lysates (WCL), nuclear (Nuc), cytosolic (Cyto), and crude mitochondrial (Mito) fractions were resolved by SDS-PAGE and processed for western blotting with the indicated antibodies. The migration of molecular weight markers is indicated on the left. (B) Graphs showing densitometric quantification of Drp1 in the indicated fractions from (A). (C) RPE-1 cells were transfected with 10 nM siCON or siDrp1 and 3 days later treated with DMSO or SFN for 4 h. Drp1 (green) was visualized with an anti-Drp1 antibody, mitochondria with MitoTracker (red), and nuclei with DAPI (blue). (D) Automated co-localization analysis of Drp1 and MitoTracker signal from (C). Data in (B) and (D) were compiled from 3 and 5 independent experiments, respectively, and statistical significance was determined by two-tailed Student’s t-test. Error bars reflect +/- S.D and asterisks denote statistical significance. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).
Sulforaphane Confers Protection Against Staurosportine-Induced Apoptosis Independent of Nrf2
Previous work has shown that mitochondrial fission is permissive in the formation of pores in the outer mitochondrial membrane generated by Bax/Bak during apoptosis [11]. Drp1 has been shown to be selectively recruited to mitochondria during apoptosis [11] and, consistent with this, fragmented mitochondria have been observed early in the process [27]. Conversely, inhibiting mitochondrial fission is thought to inhibit apoptosis by blocking the formation of the outer membrane pores that allow for cytochrome c release [53]. Accordingly, stimulating mitochondrial fusion delays the progression of apoptosis induced by compounds including staurosporine (STS) [14]. To determine whether SFN protects RPE-1 cells from STS-mediated apoptosis and if so, whether this requires Nrf2, we established an assay to readily induce poly ADP ribose polymerase (PARP) cleavage, a substrate of activated caspase-3 and definitive marker of apoptosis. Treatment of RPE-1 cells with 1 �M STS for 6 h only caused a very modest cleavage of PARP yet this was prevented by SFN co-treatment (e.g., Fig. 4A, lane 3 versus 4). To increase the robustness of this assay, we further sensitized cells to STS-induced apoptosis by pre-treating them with siRNA targeting the anti-apoptotic factor, Bcl-XL. This pretreatment reduced the expression of Bcl-XL and markedly promoted PARP cleavage as a function of time exposed to STS (Fig. 4B, compare lane 2 to lanes 4�10). Importantly, 2 h of pre-treatment with SFN mitigated PARP cleavage in cells exposed to STS (Fig. 4C, lane 3 versus 4 and lane 5 versus 6). Likewise, cells stably depleted of Nrf2 by CRISPR/Cas9 were comparably protected from STS toxicity by SFN pre-treatment (Fig. 4C, lane 11 versus 12 and lane 13 versus 14 and Fig. 4D). This protection was observed using both PARP cleavage (Fig. 4C and D) and cellular morphology (Fig. 4E) as readouts. The efficacy of Nrf2 depletion by CRISPR/Cas9 was confirmed by western blotting (Fig. 4C, Nrf2 blot). As predicted, depleting cells of Drp1, which also yields a hyperfusion phenotype (Fig. 1A), also blocked PARP cleavage in response to STS as compared to control cells incubated with SFN (Fig. 4F and G). Together, these findings are consistent with SFN conferring protection against apoptosis through its capacity to restrict Drp1 function, independent of the stabilization and activation of Nrf2.
Figure 4 The cytoprotective effects of SFN are independent of Nrf2 expression (A) RPE-1 cells were pre-treated with DMSO or 50 ?M SFN for 2 h prior to treatment with DMSO, 1 ?M staurosporine (STS), or 50 ?M etoposide for 6 h and were processed for anti-PARP western blotting. (B) RPE-1 cells were transfected with 2.5 nM siCON, 1 nM siBcl-XL, or 2.5 nM siBcl-XL and 3 days later were treated with DMSO or 1 ?M STS for 2, 4, or 6 h. Representative western blots are shown and the migration of molecular weight markers is indicated on the left. (C) CRISPR/Cas9-generated wild-type (Nrf2WT) and Nrf2 knockout (Nrf2KO) RPE-1 cells were transfected with 1 nM siBcl-XL and 3 days later were pre-treated with DMSO or 50 ?M SFN for 2 h. Subsequently, the cells were treated with 1 ?M STS for 2, 4, or 6 h. Representative western blots with the indicated antibodies are shown. (D) Quantification of cleaved PARP as a percentage of total PARP (cleaved+uncleaved) from 3 independent experiments. Importantly, the levels of cleaved PARP were comparable whether cells expressed Nrf2 or not, indicating that SFN protection from STS is independent of the transcription factor. (E) 20X phase-contrast images taken immediately prior to harvest of lysates from (C). Scale bar=65 �m. (F) Representative western blots demonstrating that depletion of Drp1 confers near-comparable protection from STS as SFN treatment. RPE-1 cells were transfected with 1 nM siBcl-XL and additionally transfected with either 10 nM siCON or 10 nM siDrp1. 3 days later, siCON cells were pre-treated with SFN as in (A) and (C) and then exposed to STS for 4 h prior to being harvested and processed for western blotting with the indicated antibodies. (G) Same as (D) for the data presented in (F) compiled from 3 independent experiments. Error bars reflect +/- S.E.M.
Discussion
We have discovered that SFN modulates mitochondrial fission/fusion dynamics independent of its effects on the KEAP1-Nrf2-ARE pathway. This is intriguing because of an assumed link between mitochondrial dysfunction and ROS production and the necessity of squelching mitochondria-derived free radicals through the activation of Nrf2. This additional functional impact of SFN is of potential importance given the more than 30 clinical trials currently underway testing SFN for the treatment of a variety of diseases including prostate cancer, obstructive pulmonary disease, and sickle cell disease [7], [10], [47].
Because SFN is an isothiocyanate [56] and it activates Nrf2 signaling by directly acylating critical KEAP1 cysteines to suppress Nrf2 degradation [21], it follows that SFN exerts its pro-fusion effects by modulating the activity of a fission or fusion factor via cysteine modification. Our data strongly support Drp1 being negatively regulated by SFN although whether the GTPase is a direct target of acylation remains to be elucidated. Despite this knowledge gap, the function of Drp1 is clearly being compromised by SFN as both mitochondria and peroxisomes become hyperfused in response to SFN treatment and these organelles share Drp1 for their respective scission events [38]. In addition, SFN decreases the amount of Drp1 that localizes and accumulates at mitochondria (Fig. 3). Because our experiments were done with all endogenous proteins, our detection of Drp1 at mitochondrial fission sites is under steady-state conditions, and consequently, we cannot distinguish between a recruitment versus a retention defect of the enzyme caused by SFN. Further, we cannot eliminate the possibility that SFN acylates a receptor at the mitochondria (Fis1 or Mff) to block Drp1 recruitment yet, we suspect that Drp1 is directly modified. Drp1 has nine cysteines, eight of which reside within the Middle Domain that is required for oligomerization [3], and one of which resides in the GTPase Effector Domain (GED) at the C-terminus of Drp1. Direct acylation of any of these cysteines could cause an activity defect in Drp1 and therefore underlie the effect of SFN on mitochondrial dynamics. Notably, prior work suggests that defects in oligomerization and catalytic activity can abrogate the retention of Drp1 at the mitochondria [52]. Cys644 in the GED domain is a particularly attractive target based on previous work showing that mutation of this cysteine phenocopies mutations that impair Drp1 GTPase activity [4] and that this particular cysteine is modified by thiol-reactive electrophiles [9]. Resolution of this outstanding question will require mass spectrometric validation.In summary, we have identified a novel, cytoprotective function for the clinically-relevant compound SFN. In addition to activating the master anti-oxidant transcription factor Nrf2, SFN promotes mitochondrial and peroxisomal fusion, and this effect is independent of Nrf2. The mechanism underlying this phenomenon involves a reduction in the function of the GTPase Drp1, the primary mediator of mitochondrial and peroxisomal fission. A major consequence of SFN-mediated mitochondrial fusion is that cells become resistant to the toxic effects of the apoptosis inducer staurosporine. This additional cytoprotective action of SFN could be of particular clinical utility in the numerous neurodegenerative diseases for which age is the leading risk factor (e.g., Parkinson’s Disease, Alzheimer’s Disease, Age-related Macular Degeneration) as these maladies have been associated with apoptosis and reduced levels and/or dysregulation of Nrf2 [35], [36], [48]. Together, these data demonstrate that the cytoprotective properties of SFN extend beyond activation of the KEAP1-Nrf2-ARE system and warrant further studies given the current use of this agent in multiple clinical trials.
Materials and Methods
Apoptosis Assays
Cells were seeded and transfected with siRNA as indicated below. The cells were pre-treated with 50 ?M sulforaphane for 2 h to induce mitochondrial fusion and were then treated with 1 ?M staurosporine to induce apoptosis. At the time of harvest, media was collected in individual tubes and subjected to high speed centrifugation to pellet apoptotic cells. This cell pellet was combined with adherent cells and solubilized in 2 times-concentrated Laemmli buffer. Samples were subjected to anti-PARP western blotting.
CRISPR/Cas9 Construct Generation
To create LentiCRISPR/eCas9 1.1, LentiCRISPR v2 (addgene #52961) was first cut with Age1 and BamH1. Next, SpCas9 from eSpCas9 1.1 (addgene #71814) was PCR amplified with Age1 and BamH1 overhangs using the following primers (Forward AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, Reverse AAGCGCGGATCCCTTTTTCTTTTTTGCCTGGCCGG) and ligated into the cut vector above. sgRNA sequences were determined by using Benchling.com. Parameters were set to target the coding sequence with the highest on-target and lowest off-target scores. The following sequences (targeting sequence underlined, hs sgNFE2L2#1 sense CACCGCGACGGAAAGAGTATGAGC, antisense AAACGCTCATACTCTTTCCGTCGC; hs sgNFE2L2#2 sense CACCGGTTTCTGACTGGATGTGCT, antisense AAACAGCACATCCAGTCAGAAACC; hs sgNFE2L2#3 sense CACCGGAGTAGTTGGCAGATCCAC, antisense AAACGTGGATCTGCCAACTACTCC) were annealed and ligated into BsmB1 cut LentiCRISPR/eCas9 1.1. Lentivirally infected RPE-1 cells were selected with puromycin and maintained as a pooled population. Knockout was confirmed by immunofluorescence and western blotting.
Cell Culture and Transfections
Human retinal pigment epithelial cells transformed with telomerase (RPE-1) (ATCC) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) containing 1 g/L glucose supplemented with penicillin, streptomycin, 1X non-essential amino acid cocktail (Life Technologies), and 10% Fetal Bovine Serum (Life Technologies). For siRNA-transfections, 30,000�35,000 cells/mL were seeded overnight. Cells received 10 nM siRNA diluted in serum-free DMEM and combined with 0.3% Interferin transfection reagent (PolyPlus). For apoptosis sensitization, cells received 1 nM Bcl-XL siRNA. Cells were harvested 2�3 days post-transfection.
Chemicals, Antibodies, and siRNA Oligos
Antibodies against ?-tubulin (Cell Signaling), ?-tubulin (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (Cell Signaling), PMP70 (Abcam), and Tom20 (BD Biosciences) were used at 1:1000 dilutions for western blotting and for immunofluorescence. In-house, anti-Nrf2 rabbit antibody was used at 1:2000 for western blotting [34], [59]. Sulforaphane (Sigma) and staurosporine (Tocris) were used at 50 ?M and 1 ?M respectively. siRNAs against Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (Cell Signaling), and Bcl-XL (Cell Signaling) were used at 10 nM unless otherwise noted.
Immunofluorescence and in Vivo Labeling
Cells seeded on 18 mm glass coverslips were treated with vehicle or drug, fixed in 3.7% formaldehyde and then permeabilized in 0.2% Triton X-100/PBS on ice for 10 min. Primary antibodies were incubated in 3% bovine serum albumin (BSA) in PBS overnight at 4 �C. Following PBS washes, cells were incubated for 1 h in species-appropriate, Alexa488- or Alexa546-, conjugated secondary antibodies (diluted 1:1000) and 0.1 ?g/mL DAPI (Sigma) in 3% BSA/PBS. Mitochondria were visualized either by anti-Tom20 immunofluorescence or by incubating cells in 200 nM MitoTracker Red CMXRos (Molecular Probes, Inc.) in serum-free DMEM for 30 min at 37 �C prior to fixation.
Microscopy and Image Analysis
Immunofluorescence samples were viewed on an LSM710 Confocal microscope (Carl Zeiss). Micrographs were captured using 63X or 100X oil immersion objectives and images adjusted and enhanced using Adobe Photoshop CS6. Co-localization analysis was performed using Carl Zeiss LSM710 co-localization feature with thresholds manually set while blinded to the identity of the samples. Scale bars throughout, unless otherwise indicated, are 10 �m. Mitochondrial morphology was assessed by blinded scoring. If the mitochondria of a cell were maintained as multiple, round, discriminate puncta, the cell was scored as �fission�. If individual mitochondria were indistinguishable and the whole mitochondrial network appeared continuous, the cell was scored as �fusion�. All other cells, including those with clustering mitochondria, were scored as �intermediate�.
Subcellular Fractionations
RPE-1 cells were grown to confluence. Following a PBS wash, cells were subjected to centrifugation at 600�g for 10 min and resuspended in 600 ?L isolation buffer (210 mM Mannitol, 70 mM Sucrose, 5 mM MOPS, 1 mM EDTA pH 7.4+1 mM PMSF). The suspension was lysed 30 times in a Dounce homogenizer. A fraction of the homogenate was preserved as a �whole cell lysate.� The remainder was subjected to centrifugation at 800�g for 10 min to pellet nuclei. Supernatants were subjected to centrifugation at 1500�g for 10 min to clear remaining nuclei and unlysed cells. This supernatant was subjected to centrifugation at 15,000�g for 15 min to pellet mitochondria. The supernatant was preserved as the �cytosolic fraction�. The pellet was washed gently with PBS and resuspended in isolation buffer. The protein concentration of each fraction was measured by bicinchoninic acid (BCA) assay and equivalent amounts of protein were resolved by SDS-PAGE.
Western Blotting
Cells were washed in PBS and solubilized in 2 times concentrated Laemmli solubilizing buffer (100 mM Tris [pH 6.8], 2% SDS, 0.008% bromophenol blue, 2% 2-mercaptoethanol, 26.3% glycerol, and 0.001% Pyrinin Y). Lysates were boiled for 5 min prior to loading on sodium dodecyl sulfate (SDS) polyacrylamide gels. Proteins were transferred to nitrocellulose membranes and the membranes were blocked for 1 h in 5% Milk/TBST. Primary antibodies were diluted in 5% Milk/TBST and incubated with the blot overnight at 4 �C. Horseradish peroxidase (HRP)-conjugated secondary antibodies were diluted in 5% Milk/TBST. Blots were processed with enhanced chemiluminescence and densitometric quantifications were performed using ImageJ software.
Sulforaphane is a chemical from the isothiocyanate collection of organosulfur substances obtained from cruciferous vegetables, including broccoli, cabbage, cauliflower, kale, and collards, among others. Sulforaphane is produced when the enzyme myrosinase transforms glucoraphanin, a glucosinolate, into sulforaphane, also known as sulforaphane-glucosinolate. Broccoli sprouts and cauliflower have the highest concentration of glucoraphanin or the precursor to sulforaphane. Research studies have demonstrated that sulforaphane enhances the human body’s antioxidant capabilities to prevent various health issues. Dr. Alex Jimenez D.C., C.C.S.T. Insight
Sulforaphane and Its Effects on Cancer, Mortality, Aging, Brain and Behavior, Heart Disease & More
Isothiocyanates are some of the most important plant compounds you can get in your diet. In this video I make the most comprehensive case for them that has ever been made. Short attention span? Skip to your favorite topic by clicking one of the time points below. Full timeline below.
Key sections:
00:01:14 – Cancer and mortality
00:19:04 – Aging
00:26:30 – Brain and behavior
00:38:06 – Final recap
00:40:27 – Dose
Full timeline:
00:00:34 – Introduction of sulforaphane, a major focus of the video.
00:01:14 – Cruciferous vegetable consumption and reductions in all-cause mortality.
00:02:12 – Prostate cancer risk.
00:02:23 – Bladder cancer risk.
00:02:34 – Lung cancer in smokers risk.
00:02:48 – Breast cancer risk.
00:03:13 – Hypothetical: what if you already have cancer? (interventional)
00:03:35 – Plausible mechanism driving the cancer and mortality associative data.
00:04:38 – Sulforaphane and cancer.
00:05:32 – Animal evidence showing strong effect of broccoli sprout extract on bladder tumor development in rats.
00:06:06 – Effect of direct supplementation of sulforaphane in prostate cancer patients.
00:07:09 – Bioaccumulation of isothiocyanate metabolites in actual breast tissue.
00:08:32 – Inhibition of breast cancer stem cells.
00:08:53 – History lesson: brassicas were established as having health properties even in ancient Rome.
00:09:16 – Sulforaphane’s ability to enhance carcinogen excretion (benzene, acrolein).
00:09:51 – NRF2 as a genetic switch via antioxidant response elements.
00:10:10 – How NRF2 activation enhances carcinogen excretion via glutathione-S-conjugates.
00:10:34 – Brussels sprouts increase glutathione-S-transferase and reduce DNA damage.
00:11:20 – Broccoli sprout drink increases benzene excretion by 61%.
00:13:31 – Broccoli sprout homogenate increases antioxidant enzymes in the upper airway.
00:15:45 – Cruciferous vegetable consumption and heart disease mortality.
00:16:55 – Broccoli sprout powder improves blood lipids and overall heart disease risk in type 2 diabetics.
00:19:04 – Beginning of aging section.
00:19:21 – Sulforaphane-enriched diet enhances lifespan of beetles from 15 to 30% (in certain conditions).
00:20:34 – Importance of low inflammation for longevity.
00:22:05 – Cruciferous vegetables and broccoli sprout powder seem to reduce a wide variety of inflammatory markers in humans.
00:36:32 – Sulforaphane improves learning in model of type II diabetes in mice.
00:37:19 – Sulforaphane and duchenne muscular dystrophy.
00:37:44 – Myostatin inhibition in muscle satellite cells (in vitro).
00:38:06 – Late-video recap: mortality and cancer, DNA damage, oxidative stress and inflammation, benzene excretion, cardiovascular disease, type II diabetes, effects on the brain (depression, autism, schizophrenia, neurodegeneration), NRF2 pathway.
00:40:27 – Thoughts on figuring out a dose of broccoli sprouts or sulforaphane.
00:41:01 – Anecdotes on sprouting at home.
00:43:14 – On cooking temperatures and sulforaphane activity.
00:43:45 – Gut bacteria conversion of sulforaphane from glucoraphanin.
00:44:24 – Supplements work better when combined with active myrosinase from vegetables.
00:44:56 – Cooking techniques and cruciferous vegetables.
Heating Decreases Epithiospecifier Protein Activity and Increases Sulforaphane Formation in Broccoli
Abstract
Sulforaphane, an isothiocyanate from broccoli, is one of the most potent food-derived anticarcinogens. This compound is not present in the intact vegetable, rather it is formed from its glucosinolate precursor, glucoraphanin, by the action of myrosinase, a thioglucosidase enzyme, when broccoli tissue is crushed or chewed. However, a number of studies have demonstrated that sulforaphane yield from glucoraphanin is low, and that a non-bioactive nitrile analog, sulforaphane nitrile, is the primary hydrolysis product when plant tissue is crushed at room temperature. Recent evidence suggests that in Arabidopsis, nitrile formation from glucosinolates is controlled by a heat-sensitive protein, epithiospecifier protein (ESP), a non-catalytic cofactor of myrosinase. Our objectives were to examine the effects of heating broccoli florets and sprouts on sulforaphane and sulforaphane nitrile formation, to determine if broccoli contains ESP activity, then to correlate heat-dependent changes in ESP activity, sulforaphane content and bioactivity, as measured by induction of the phase II detoxification enzyme quinone reductase (QR) in cell culture. Heating fresh broccoli florets or broccoli sprouts to 60 �C prior to homogenization simultaneously increased sulforaphane formation and decreased sulforaphane nitrile formation. A significant loss of ESP activity paralleled the decrease in sulforaphane nitrile formation. Heating to 70 �C and above decreased the formation of both products in broccoli florets, but not in broccoli sprouts. The induction of QR in cultured mouse hepatoma Hepa lclc7 cells paralleled increases in sulforaphane formation.
Pre-heating broccoli florets and sprouts to 60 �C significantly increased the myrosinase-catalyzed formation of sulforaphane (SF) in vegetable tissue extracts after crushing. This was associated with decreases in sulforaphane nitrile (SF Nitrile) formation and epithiospecifier protein (ESP) activity.
In conclusion, sulforaphane is a phytochemical found in broccoli,and other cruciferous vegetables. An uncontrolled amount of oxidants caused by both internal and external factors can cause oxidative stress in the human body which may ultimately lead to a variety of health issues. Sulforaphane can activate the production of Nrf2, a transcription factor that helps regulate�protective antioxidant mechanisms that control the cell’s response to oxidants. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Back pain�is one of the most prevalent causes of disability and missed days at work worldwide. Back pain attributes to the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments, and muscles, among other soft tissues. Because of this, injuries and/or aggravated conditions, such as�herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief.
For people struggling to control their blood glucose levels, the most common concern is, how can you regulate blood sugar levels? Maintaining healthy blood sugar levels can be complicated and unyielding. Along with food and beverages, our blood sugar levels fluctuate in response to a huge variety of unique factors. Exercise, psychological stress, the previous night’s rest, and genetics all play a role in the human body’s effort to closely regulate the degree of glucose circulating in the blood. Additionally, no matter whether or not somebody has a blood glucose dysregulation problem or full-blown diabetes, that morning meal we call breakfast actually sets the stage for your day.
What is often known as the “Dawn Phenomenon” occurs between 4:00 AM to 8:00 AM when the human body produces sufficient amounts of glucagon, cortisol and epinephrine to boost blood glucose as a natural procedure before waking up in the morning. And science supports those people who prefer to eat a hearty breakfast as soon as they wake up. One study that monitored the sugar profiles of healthy people during the day saw that the largest increase in blood glucose occurs right after breakfast. Just about every nutritionist, dietitian and endocrinologist recommends eating a high-protein breakfast so as to restrain the naturally-occurring spike in sugar during the daytime. As mentioned previously, these meals, as well as other variables, will dictate the difference in blood glucose levels throughout the day, which directly impacts the way the human body works and an individual’s overall awareness of their health and wellness.
When Maintaining Healthy Blood Sugar Levels is Difficult
A consistently higher blood sugar level has a deleterious impact on organ function. Risks for diabetes, further heart disease, stroke, kidney disorders, vision impairment and cardiovascular issues that can result in infections and amputation of recurrence increase when blood sugar is uncontrolled. Intense oscillations in blood sugar may stem from many hormonal imbalances, specifically where there is a lack of insulin manufacturing, as in the case of type I diabetes, or an inability to use insulin correctly, commonly referred to as insulin resistance. Either type of diabetes is recognized and monitored with many evaluations, but the most prevalent one is the HbA1C. As a mark of longer-term glucose levels, the HbA1C suggests the average proportion of the particular hemoglobin subtype A1C that has glucose bound to it, glycated or glycosylated, producing a glycoprotein. Since hemoglobin cells normally die off after 120 days, this process firmly reflects the typical plasma glucose level over in the past 90 days. This diagnostic tool proves more helpful than a diagram of blood sugar, which shows great vacillations through the day. Individuals with diabetes or more lengths of hyperglycemia, as noticed in patients diagnosed with metabolic syndrome, have increased HbA1C levels. It’s projected that in 2015 over 7 million cases of diabetes and insulin resistance went undiagnosed. The famed incidence of those conditions is alarming as the trend is nearing 10 percent of the populace.
Regulating Blood Glucose Levels with Nutrition
Though genetics�are not something people can control, nutrition, diet and other lifestyle variables are within your reach. Eating a balanced diet of low-glycemic, high fiber, and also low-saturated fat meals is recommended for individuals with glycemic control health issues. Combining foods which contain all three macronutrients, such as proteins, fats, and carbohydrates, can also be valuable in regulating blood glucose levels. This list of foods provides a wonderful start to a healthy diet and a platform for preventing those wild swings in sugar throughout the day:
All colors and varieties of fresh fruits and vegetables
Legumes, such as kidney beans, black beans, chickpeas, and lentils
Whole grains, such as brown rice, quinoa, barley, and millet
Olive oil
Tomatoes
Fermented, organic and raw dairy
Cold-water wild fish, such as salmon, mackerel and sardines
Tempeh, tofu and natto
Cage-free, organic eggs
Green and black tea
Supplemental nutrients and botanicals to help encourage wholesome glucose levels and supply a hypoglycemic effect are currently being studied and comprise of:
Magnesium
Chromium, as chromium picolinate
Vanadium
Alpha lipoic acid
Gymnema sylvestre
Fenugreek
Bitter melon
Cinnamon
Berberine
Berberine functions on multiple fronts. It was found to substantially improve glucose levels by an average of 9.5 percent down to 7.5 percent, as effective as metformin from 9.15 percent down to 7.7 percent, in a research study to find out its effectiveness and safety in type 2 diabetes patients. Furthermore, it had the effect of enhancing both entire cholesterol and low-density lipoprotein cholesterol in the evaluation and analysis.
Dr. Alex Jimenez’s Insight
Diabetes has become one of the fastest growing diseases in the United States, where it is prevalent among both children and adults. With the increase in cases each year, the numbers of individuals seeking treatment and a potential cure are also rising. Fortunately, research studies have found that maintaining healthy blood sugar levels can help stabilize a case of diabetes. Proper nutrition, as well as natural remedies and botanicals, including alternative treatment options, such as chiropractic care, have been determined to help regulate healthy blood glucose levels, improving an individual’s quality of life.
While there are many other ways in which healthy blood sugar levels can be achieved, recent research studies have also determined that chiropractic care may be able to control blood sugar levels, potentially regulating type 2 diabetes. According to these, the key to managing blood glucose levels can be found in the connection between the central nervous system and blood sugar levels in the human body. Chiropractic care focuses on the use of spinal adjustments and manual manipulations to correct spinal misalignments, or subluxations. It has been demonstrated that spinal misalignments, or subluxations, can interfere with important communications signals from the brain to the spinal chords as well as the rest of the body. By carefully restoring the natural integrity of the spine, chiropractors can help regulate healthy blood sugar levels and improve overall health and wellness.
Sleep disorders, such as obstructive sleep apnea, commonly related to obesity and metabolic syndrome, can hinder good quality sleep, and also have been considered as a risk factor for diabetes. Although there isn’t any clearly defined correlation between sleep and glucose control, there are multiple pathways involved together with a cascade of metabolic functions which could result in metabolic derangements when disturbed.
To remain steady on what could be a roller coaster ride of blood sugars, a high priority should be given to a well-balanced diet plan, replete with proper nutrition and supplementation, and the close observation of lifestyle and genetic aspects. The scope of our information is limited to chiropractic as well as to spinal injuries and conditions. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Curated by Dr. Alex Jimenez
Additional Topics: Back Pain
Back pain is one of the most prevalent causes for disability and missed days at work worldwide. As a matter of fact, back pain has been attributed as the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience some type of back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments and muscles, among other soft tissues. Because of this, injuries and/or aggravated conditions, such as herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief.
How important is nutrition for our brain health? In the current work force, we are continuously stressed, often forced to finish tasks faster in order to meet ever so demanding deadlines. In addition, we are expected to maintain our optimal mental health, as this can be an essential�part towards delivering quality work. When our mental health is being affected by our hectic lifestyles, however, several practices which can help you start thinking more clearly can include sleeping properly, controlling stress, and even taking nutritional supplements for your brain health.
One nutritional supplement which has been widely recognized for its ability to boost brain health is curcumin, the active ingredient found in turmeric. Well-known for its antioxidant properties and its capacity to control inflammation in the human body, this powerful herb can also promote good mood and cognition. Another specific group which has reported significant benefits with the increased use of curcumin, is the elderly population. Below, we will discuss how curcumin can help boost brain health as well as demonstrate additional benefits this golden gem can have on our overall health and wellness.
Curcumin: a Golden Gem for Brain Health
In accordance with the Journal of Pharmacology, curcumin is made-up of a variety of substances which can encourage biological mechanisms that counteract age-related cognitive decline, dementia, or mood disorders. One randomized, double-blind, placebo-controlled trial analyzed the acute, of approximately 1 and 3 hours following a single dose, chronic, of approximately 4 weeks, and acute-on-chronic, of approximately 1 and 3 hours after one dose subsequently after chronic treatment, consequences of a curcumin formulation on cognitive function, mood, and blood biomarkers in 60 healthy adults ranging from the 60 to 85 years of age. After about one hour of application, the curcumin had considerably enhanced the participant’s functionality on attention and working memory tasks, in comparison with the placebo. Working memory and mood, which included general fatigue, change in calmness, contentedness and fatigue triggered by emotional strain were fundamentally improved following chronic therapy.
Curcumin boosts BDNF (brain-derived neurotrophic factor), the brain hormone which helps boost the development of new neurons that are in charge of improving memory and learning as well as supplying a substantial option for countering the aging brain. Additionally, this powerful ingredient increases blood circulation to the brain, also providing a much better attention span for greater work productivity.
Appreciating its anxiolytic effects can be one of the greatest benefits of carrying curcumin. According to the Journal of Clinical Psychopharmacology, a randomized double-blinded and double-blind trial with 60 subjects experiencing stress-related symptoms, including exhaustion, were to get routine curcumin nutritional supplements, and placebo for 30 days. The results indicated a greater quality of life, and diminished stress and fatigue for those receiving regular curcumin intakes. This progressive compound is believed to be able to help alleviate depression by altering the release of dopamine and serotonin, two powerful hormones which help keep the human mind and body at ease. Curcumin also promotes the optima health and wellness of inflammation pathways from the brain, which ultimately will help improve energy, mood, and production levels.
Curcumin may additionally promote cognition via its powerful antioxidant action which improves the bioavailability of DHA, the potent omega-3 fatty acid demonstrated to boost brain health. A research study in the American Journal of Geriatric Psychiatry revealed that curcumin really does protect the brain from neurodegeneration. The evaluation and analysis included 40 participants ranging from the ages of 51 to 84 years of age. Each individual subject consumed 90mg of curcumin twice per day or placebo for 18 weeks. The results indicated enhanced long-term healing, visual memory, and focus. With its tremendous medicinal properties, curcumin can also support neuroplasticity, which empowers the brain to change and fortify itself even through the natural degeneration with aging.
Curcumin can also promote anti-seizure action. With its antioxidant properties, this golden gem can help slow down reactive astrocyte expression, which helps cells survive within the mind. According to the Neuropharmacology Laboratory, Department of Pharmacology, the antioxidant properties of curcumin helped alleviate migraines, cognitive impairment, and cognitive stress in rats. A dental pre-treatment of curcumin was given to male rats which were additionally treated together with Pentylenetrazole, or PZT, every other day. The study demonstrated that curcumin enhanced the seizure score and indicated a diminished amount of myoclonic jerks. Furthermore, the outcome measures of the research study demonstrated that curcumin restructures seizures, oxidative stress, and brain function. Moreover, it helps protect memory function which may also be jeopardized by seizure activity.
Using its capability to strengthen fatty acids in the mind, curcumin helps athletes achieve better physical performance by boosting critical thinking, improving problem solving, and developing improved choices. The neuroprotective properties in curcumin also help regenerate tissues. In reality, based on Stem Cell Research and Therapy, a research study was conducted between the effects of curcumin on endogenous stem cells which were impartial. The study demonstrated that curcumin played an essential role in the healing of cells from combating the activation of microglia cells. Scientists in the Institute of Neuroscience and Medicine in Julich, Germany, observed the effects of impartial stem cell generation. During a 72-hour period, the evaluation and analysis demonstrated and indicated that the turmeric curcumin improved cellular generation by up to 80 percent. This shows how powerful curcumin could be for successful brain health function.
Dr. Alex Jimenez’s Insight
Nutrition is a fundamental factor in overall health and wellness. In today’s stressful world, however, it can often become difficult to eat a proper meal, let alone making sure we are taking in all the necessary nutrients we require on a regular basis. That, plus the added pressure of the workforce can have detrimental effects on our brain health. Dietary supplements, such as curcumin, have been demonstrated to have tremendous benefits on brain health. Although we may not always have the “free time” to sit down and have a properly balanced meal, taking nutritional supplements like curcumin, among others, can help improve the human body’s general well-being.
While many research studies have found that natural remedies and botanicals, such as dietary supplements apart from vitamins and minerals, continue to be the most common complementary health approach in the United States today, more and more alternative treatment options, such as chiropractic care, have started to incorporate these into their practices. As a matter of fact, a majority of chiropractors give nutritional advice, as well as recommendations for other lifestyle recommendations, as a general part of their treatment plan. Because chiropractic care is based on the notion of naturally treating the human body as a whole, enhancing it’s own healing properties without the use of drugs and/or medications as well as other invasive procedures, this healthcare profession relies on offering the necessary health maintenance components for optimal health and wellness. These components can include nutrition, water, rest, exercise, and clean air. Many chiropractors also offer curcumin supplements to help promote recovery.
This exceptional nutritional supplement, curcumin, helps improve mental clarity, improve cognition, improve endurance, and supplies anxiolytic benefits. Whether it’s more work fabricating, or a much better disposition, curcumin is a hidden golden gem for health.�The scope of our information is limited to chiropractic as well as to spinal injuries and conditions. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Curated by Dr. Alex Jimenez
Additional Topics: Back Pain
Back pain is one of the most prevalent causes for disability and missed days at work worldwide. As a matter of fact, back pain has been attributed as the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience some type of back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments and muscles, among other soft tissues. Because of this, injuries and/or aggravated conditions, such as herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief.
Irrespective of a continuous surge in interest regarding the ketogenic diet, exactly why is it that individuals have been utilizing this dietary pendulum swing from the�nutritional worries that have been spreading across the world? Many people appear to be�obsessed with the latest diet fads and trends associated with achieving and maintaining a balanced weight and supporting overall health and wellness. Research studies have demonstrated evidence outcomes regarding the benefits of dieting.
The National Weight Control Registry has stored data about these types of ongoing research studies. More than half of subjects involved in these varieties of tests and evaluations had revealed that they were following some sort of diet or intended to become involved in programs or routines for weight loss. You often see annual reports listing the very best diets, including: the Top 5 Diets to Try in 2018, According to Experts, published by Time magazine. Moreover, the report claims that healthcare professionals have ranked the DASH Diet as the number one diet, followed by the Mediterranean Diet, Weight Watchers, the MIND diet, the TLC Diet and Volumetrics, as the top diets to try this year. The article, however, additionally discusses the ketogenic diet and ranks it as being among one of the lowest-ranked diets to try this year. No further details are given about this diet and the consensus appeared to be that it is challenging to follow.
However, the ketogenic diet is actually one of the most popular diets people generally talk about, subtly out-ranking paleolithic diet in most conversations. As a matter of fact, you may have already read or heard about the ketogenic diet from a variety of sources or perhaps you may even known a friend or a family member who has been trying it out themselves. A frequent concern about popular or fad diets, though, is that there doesn’t seem to be an exact guide on how to properly follow them, what kinds of problems they may cause, and/or even for whom these might be most appropriate. With eating habits like those described in the ketogenic diet, there are frequently risks or disadvantages, often involving nutrient deficiencies or lack of efficacy, especially if they’re truly hard to follow. But, how can this common issue regarding the proper diet be solved? Foremostly, it’s essential for individuals to weigh the advantages and disadvantages when choosing to attempt the ketogenic diet.
What is the Ketogenic Diet?
Let’s start with some history of what, where and when the ketogenic diet begain. There are various diets out there today which may have a lot in common with this well-known diet. Simply take a peek at a newstand, a bodybuilding website, or maybe the blogs of practicing healthcare professionals. First developed in 1921 by Dr. Russell Wilder of the Mayo Clinic as an alternative for children with intractable epilepsy, a classical ketogenic diet is supposed to alter the human body’s natural inclination to metabolize carbohydrates for energy. This can be achieved by adjusting an individual’s nutritional daily value to a particular macronutrient intake ratio of 4:1 fat-to-carbohydrates and protein diet. In this arrangement, fat comprises approximately 90 percent of daily calories, together with 7 percent of proteins and 3 percent of carbohydrates. Some alternatives for the ketogenic diet include a Medium Chain Triglyceride Diet consisting of 70 percent of fats, 10 percent of proteins and 20 percent of carbohydrates, or a Modified Atkins Diet with much more protein including 70 percent of fats, 25 percent of proteins, and 5 percent of carbohydrates, and a Low-Glycemic Index Treatment consisting of 45 percent of fats, 28 percent of proteins and 27 percent of carbohydrates.
The consequence of eating in this manner mimics what occurs when engaging in physical activities or exercise as well as what happens when fasting, a process referred to as ketosis. In ketosis, there is a depletion of glycogen reserves in the muscles and in the liver, which ultimately causes the liver to produce ketone bodies that can be used as fuel instead. Some healthcare professionals advise using either ketone strips or a sugar ketone meter to test the levels of ketosis in urine or blood. There is also a breath ketone analyzer available for purchase on Amazon. Don’t confuse ketosis with ketoacidosis, or the potentially deadly condition common to Type 1 diabetics when there are incredibly substantial levels of blood glucose and ketones.
Proof the Ketogenic Diet Works
It goes without saying, when a new dietary routine is useful for weight loss, nutrition experts understand they may also be used therapeutically for the treatment of many different diseases and ailments, among other health issues. The ketogenic diet has been used for decades to help with the treatment of epilepsy, and it has gained recent traction in its use for the treatment of obesity, type 2 diabetes, cardiovascular disease and neurological disorders. It has even been demonstrated to positively affect the gut microbiota.
Research studies regarding the use of a very-low carbohydrate, high fat diet for obesity, however, is in its initial stages. One research study, retrospectively in comparison to a non-carb/ketogenic-style diet, utilized a classic low-carb diet in bariatric patients, focusing on weight loss. The researchers found comparable weight-loss between both diets by 12 months post-intervention. Nonetheless, the ketogenic dieters that obtained follow-up guidance on a restricted carbohydrate routine had the best success following 24 months, indicating importance of care regarding an individual’s specific dietary habits.
One masterpiece post from 2008 clearly outlines the benefits of restricting carbohydrates to cause a unique metabolic state that favorably impacts atherogenic dyslipidemia, fatty acid partitioning and metabolic syndrome. The report clearly demonstrates that ketone bodies represent an efficient fuel for the body, about 25 percent more efficient at producing ATP than glucose or fatty acid, with curative potential towards numerous health issues. Following a carbohydrate-restrictive diet might also lead to a decrease in the release of pro-inflammatory chemicals, substances and compounds, which ultimately has positive implications for cardiovascular health.
On the reverse side, another research study found that the information on the effects of ketogenic diets on cardiovascular disease appeared to be contradictory in animal and human studies to produce an astounding recommendation. Recently presented in the 2018 American Diabetes Association seminar, a research study consisting of a 2-year randomized controlled trial, compared a high-carbohydrate diet to some very-low carbohydrate, like the ketogenic diet, with a reduced saturated fat diet in type 2 diabetic subjects. Both diets provided similar weight loss and reductions in HbA1c, whereas the very-low carbohydrate diet enabled participants to reduce their use of drugs/medications and improved their diurnal blood glucose equilibrium and blood lipids.
Missing Link in Keto Diet
One challenge that many healthcare professionals often face, however, is that sometimes, the ketogenic diet can make you feel sick. There is even a term for this: the Keto Flu. This is mostly because of a change in electrolyte conditioning together decreased insulin levels, resulting in a greater need for potassium, magnesium and sodium. If not properly managed, it can lead to nutrient deficiencies of those electrolytes, among different micronutrients, that may have consequences not completely elucidated as a result of the paucity of research on the long-term use of the ketogenic diet. Sodium is generally over-consumed in a typical diet, and a lot of high-sodium foods make their way into ketogenic diet cured meats, cheeses, and other foods that are processed. But most individuals in Western cultures today do not get enough potassium or magnesium, found mainly in fruits and vegetables, which may play a fundamental role in the pathology of chronic diseases like stroke and kidney stones.
A 2007 research study emphasized the risk factors for kidney stones after following the ketogenic diet. Approximately 6.7percent of the children who have been prescribed the ketogenic diet for intractable epilepsy were reported to have developed kidney stones. In these cases, utilizing potassium citrate significantly diminished the incidence of kidney stones and increased the expression time on the ketogenic diet. Potassium citrate solubilizes calcium, thus decreasing concentrations of free calcium readily available to crystallize. Additionally, it will also help to improve urine pH, helping to dissolve uric acid crystals. The research study concluded that “oral potassium citrate in clinical and prospective studies, using this treatment empirically was justified.”
Dr. Alex Jimenez’s Insight
The ketogenic diet, or the keto diet for short, is a low-carb, high-fat diet which has been previously described to offer many heath benefits. As a matter of fact, numerous research studies have demonstrated how this type of diet can help with weight loss as well as help improve overall health and wellness. The ketogenic diet may often be described as a “difficult to follow” diet because it involves drastically reducing carbohydrate intake to replace it with fat. However, its this reduction in carbs which allows the human body to enter a metabolic state known as ketosis. Once the human body enters ketosis, it becomes tremendously efficient in burning fat and turning it into energy, additionally turning fats into ketones in the liver, supplying energy directly to the brain. This, along with reductions in blood sugar and insulin levels, can have a variety of health benefits, making the ketogenic diet suitable for individuals with specific health issues.
Advice on the Keto Diet
If you would like to try the ketogenic diet or feel like it would benefit you in any sort of way, first make sure to check with your healthcare professional. There are a number of resources online and in texts that aren’t all peer-reviewed. Use the information with care and listen to your own body. Remember: this kind of diet requires additional understanding of biochemical processes, it may behard to follow due to its limitations and possible lack of palatability, and it has to be limited in length. Also, based on one’s genetics, the keto diet can yield quite different outcomes.
Nutrition is a fundamental part of overall health and wellness. Proper nutrition can ultimately affect the way an individual’s bodily system’s functions and without it, a variety of structures and functions can be affected. If you are seeking treatment for a specific health issue, nutrition becomes even more important. Chiropractic care focuses on the natural treatment of the spine, through the use of spinal adjustments and manual manipulations, as well as through the implementation of lifestyle modifications, to provide the human body with all the necessary components it needs to heal itself, without the use of drugs/medications and/or surgery. Many chiropractors often recommend the ketogenic diet, alongside chiropractic care, to improve well-being. Be sure to talk to your doctor of chiropractic, or DC, regarding any nutrition plan you want to follow and they can discuss the best options for your specific health issues and basic treatment needs.
That made clear, there are some smart recipes available on the marketplace to rival those which have observed from the fantastic Paleo popularity. One standout origin for the ketogenic diet is the Charlie Foundation website, which was put up to give dietary advice for caregivers of young children with uncontrolled epilepsy. Check out their site for ideas to feed your keto. The scope of our information is limited to chiropractic as well as to spinal injuries and conditions. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.
Curated by Dr. Alex Jimenez
Additional Topics: Back Pain
Back pain is one of the most prevalent causes for disability and missed days at work worldwide. As a matter of fact, back pain has been attributed as the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience some type of back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments and muscles, among other soft tissues. Because of this, injuries and/or aggravated conditions, such as herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief.
Vegan and vegetarian diet have long been touted as some of the healthiest diets for people of all walks of life. There is a lot of confusion and many misconceptions, though, about the two.
What most people don�t realize is that there are many sub-category diets that fall under vegetarianism, some of which include animal by-products, seafood, and even meat. Understanding veganism and vegetarianism as well as knowing the benefits of these diets can help chiropractic patients stay healthier, get more active, and stave off many chronic illnesses.
Is There A Difference Between Vegan & Vegetarian Diets?
There are distinct differences between veganism and vegetarianism although many books and even food companies fail to clearly distinguish the two. While it is true that they are very similar diets, the differences are significant.
Vegans do not eat any animal by-products or animal flesh at all. This includes seafood. They also do not use products that use animal testing or that are made from animals including leather products.
On the other hand, vegetarians typically abstain from eating animal flesh, but do often eat animal by-products such as dairy products and eggs. Some also eat seafood including fish, shrimp, and crab. They are also a little more relaxed when it comes to the products they purchase as well.
What Is A Vegetarian Diet?
The vegetarian diet comes in several varieties. The standard vegetarian diet consists of eggs and dairy products but excludes fish and meat. This is also called a �lacto ovo vegetarian.� However, some vegetarians include dairy products but exclude eggs while others include the eggs and exclude the dairy. A �demi-vegetarian� includes seafood.
There are also what are known as �semi-vegetarians� although there is some controversy over whether they should be classified as vegetarian or not.
Pollo Vegetarian � includes poultry but excludes other meats and seafood.
Pesco Vegetarian � includes fish and chicken but excludes red meat.
Flexitarian � includes any kind of meat whenever they want but adhere mainly to a standard vegetarian diet.
What Is A Vegan Diet?
A vegan diet excludes all animal by products and meats. True vegans do not use or wear anything derived from animals (leather, snakeskin, etc.) or that is tested on animals. Most vegans tend to avoid sodas, sugary sweets, processed foods, and ready-meals, while choosing organic, high quality foods.
Still, there are a few variations of veganism too. For instance, a raw vegan combines a vegan diet with a raw diet meaning that they exclude all products and foods of animal origins as well as food that has been cooked at a temperature greater than 118 degrees Fahrenheit.
The Paleo vegan is defined by the types of foods that are eaten. It is still meat and animal product free, but the foods that are chosen are selected from the Paleo diet.
This type of diet centers on certain types of foods that are believed to have been consumed during the Paleolithic era. It includes fish, meat, fruit, and vegetables but excludes grain and dairy products. Of course, for vegan purposes, the meat and fish are excluded.
What Are The Benefits Of Vegan & Vegetarian Diets?
Vegetarian and vegan diets have many health benefits. The tend to be much higher in vitamins C and E, magnesium, folic acid, and potassium. The fat content tends to be more unsaturated.
Vegan diets typically have less cholesterol and unsaturated fat that vegetarian diets and they contain more fiber. This translates to lower blood pressure, lower serum cholesterol, less risk of diabetes and heart disease, and much lower incidence of obesity. While some of these diets may require certain vitamin supplements such as calcium, vitamin D, vitamin B-12, and omega 3 fatty acids, most doctors agree that vegan and vegetarian diets are very healthy when done correctly.
Injury Medical Clinic: Migraine Treatment & Recovery
There has been a lot in the media lately about alkalinity and acidity in the body, but finding solid, straightforward information isn�t always easy. In short, acidity can cause a number of health issues. There are many benefits of bringing your body into balance.
What Is High Acidity?
The term acidity describes a condition where the body is affected by the excess production of gastric acids. Under normal conditions, hydrochloric acid is secreted by the stomach, aiding in the digestion and breakdown of food.
However, when this normal process is triggered in such a way that it causes overproduction of the acid, it can result in health problems. Acidity can be caused by irregular eating patterns, fad diets, alcohol consumption, stress, smoking, an unhealthy diet, and a sedentary lifestyle. Symptoms can include:
Indigestion
Burning in the stomach
Belching
Sour taste
Burning in the throat
Constipation
Nausea
Restlessness
What Are The Dangers Of High Acidity In The Body?
When the body is acidic, it can affect everything from immunity to neurological function to bone health. The Japanese have linked acidity to degenerative diseases like arthritis, cancer, and osteoporosis.
An acidic body is also a very hospitable environment for bacteria and viruses to thrive meaning the person will often get sick more often. When the body is out of balance it becomes susceptible to conditions as simple as dandruff and as complex as diabetes. Interestingly, many people have reversed or gone into remission by simply bringing their body into balance.
What Is Alkalinity?
In order to understand alkalinity, you need to understand pH levels. This is the measure used to determine how alkaline or acid something is. A pH of 0 is at the acidic end of the scale and means the thing being measured is completely acidic. At the other end of the scale, a pH of 14 is totally alkaline. The neutral point is a pH of 7.
Different parts of the body have different pH levels, meaning that some parts are more acidic while others are more alkaline. For instance, blood typically has a pH that is between 7.35 and 7.45, making it slightly alkaline. The stomach, on the other hand, is highly acidic, registering a pH of 3.5 or lower. Making the body more alkaline is not about making it completely alkaline � you need some acidity, it is necessary for digestion and other processes � it is more about bringing the body into balance.
What Are The Benefits Of Alkalinity?
When the body has increased alkalinity, bringing it into better pH balance, it is healthier and has a decreased risk of chronic illness. There is also less likelihood of illness. When the body is in a better pH balance it can result in many benefits including:
More energy
Improved cognitive function
Slowed aging process
Weight loss
Lower cancer risk
Decreased risk of chronic illness
Increased immunity
How Can You Bring Your Body Into Balance?
The best way to bring your body into better pH balance is by modifying your diet. As a rule of thumb, animal based foods like meat, eggs, and dairy tend to be more acidic. A vegetarian diet rich in plant-based foods like vegetables and fruits tend to be more alkaline. While the body does need a diet that includes both acidic and alkaline foods, a diet of processed foods and foods high in fat and sugar can cause too much acidity. By adjusting the diet, eliminating processed foods, and maintaining a healthier, more vegetarian based diet, you can bring your body into balance and enjoy better health as a result.
Injury Medical Clinic: Elderly & Geriatric Fitness
Diets: The statistics are sobering. The typical American diet far exceeds the daily recommended intake levels in calories from sugars and solid fats, sodium, refined grains, and saturated fat. It is also lacking in the recommended amounts of fruits, vegetables, dairy, whole grains, and oils. The result is obesity and experts project that by 2030, in the United States alone, half of all adults will be obese.
That�s when people start dieting � and that is what gets them into trouble.
Diet vs. Lifestyle Change
Bottom line, diets are temporary. There are some serious consequences that can come from dieting, especially fad or crash diets. The effects of these types of diets can also seriously impact your chiropractic care, hindering your progress.
Also, because diets are temporary, once you return to your regular eating habits the weight usually comes back.
A lifestyle change is a far better choice. It involves making smart, healthy eating choices � choices that you maintain for the rest of your life. This also impacts your chiropractic care by strengthening your body and keeping it healthy so that it is in an optimal state for healing and responds well to treatment.
Types Of Diets
There are all sorts of diets out there. Some are blatantly unhealthy but others are sneaky. They come with claims of being healthy, of being created or endorsed by doctors, or include tons of vitamin supplements but very limited food intake. It is important to be able to spot these destructive fad diets so you don�t get suckered into their hype.
Some of the most common types of fad diets include high protein, low or no carb, liquid, cabbage, grapefruit, broth or juice, and food combining. Some of these can cause serious health problems including vital organ damage. Others can cause vitamin deficiencies and dehydration. None of them can (or should) be maintained over a long period of time, much less the rest of your life.
The Dangers Of Diets
Unhealthy dieting can come with some pretty scary dangers. Because they typically omit key foods or food groups your body can become imbalanced. Some of the dangers of dieting include dehydration, fatigue, weakness, vitamin and mineral deficiency, headaches, nausea, diarrhea, constipation, mental fogginess, loss of muscle mass, organ damage, and even heart attack and stroke.
One popular diet restricts carbs, often cutting them out completely. This includes all whole grains (which have vital minerals and fiber) as well as many fruits and vegetables. The result is a diet that is mostly protein and fat.
While the dieter may lose some weight on this plan, it is at a great cost. The extremely high intake of protein which exceeds the levels that the body should have can cause liver and kidney failure. The omission of vital grains, fruits, and vegetables can lead to serious vitamin deficiencies while the increased fat intake can lead to heart attack and stroke.
If a diet eliminates any of the key foods (lean meats, whole grains, fruits, and vegetables), it advocates losing more than 2 or 3 pounds a week, or it restricts caloric intake to less than 1,200 calories a day it is potentially unhealthy and should only be done 1) under a doctor�s close supervision, and 2) on a very temporary basis.
Healthy Eating Is A Lifestyle
When you make the life changing commitment to adopt a healthy eating lifestyle you open yourself up to a world of better health, more energy, and better focus. Your body will heal faster and you will feel better.
A diet of fresh fruits and vegetables, lean meats, fresh fish, and whole grains, along with lots of water should become a way of life. It is far healthier than the temporary diets that are out there and more effective too.
If you or a loved one need additional dietary guidance, give us a call. Our Doctor of Chiropractic is here to help!
IFM's Find A Practitioner tool is the largest referral network in Functional Medicine, created to help patients locate Functional Medicine practitioners anywhere in the world. IFM Certified Practitioners are listed first in the search results, given their extensive education in Functional Medicine