ClickCease
+1-915-850-0900 spinedoctors@gmail.com
Select Page

Functional Medicine

Back Clinic Functional Medicine Team. Functional medicine is an evolution in the practice of medicine that better addresses the healthcare needs of the 21st century. By shifting the traditional disease-centered focus of medical practice to a more patient-centered approach, functional medicine addresses the whole person, not just an isolated set of symptoms.

Practitioners spend time with their patients, listening to their histories and looking at the interactions among genetic, environmental, and lifestyle factors that can influence long-term health and complex, chronic disease. In this way, functional medicine supports the unique expression of health and vitality for each individual.

By changing the disease-centered focus of medical practice to this patient-centered approach, our physicians are able to support the healing process by viewing health and illness as part of a cycle in which all components of the human biological system interact dynamically with the environment. This process helps to seek and identify genetic, lifestyle, and environmental factors that may shift a person’s health from illness to well-being.


What Is Sulforaphane?

What Is Sulforaphane?

Sulforaphane is a phytochemical, a substance within the isothiocyanate group of organosulfur compounds, found in cruciferous vegetables, such as broccoli, cabbage, cauliflower, and Brussels sprouts. It can also be found in bok choy, kale, collards, mustard greens and watercress. Research studies have shown that sulforaphane can help prevent various types of cancer by activating the production of Nrf2, or nuclear factor erythroid 2-related factor, a transcription factor which regulates�protective antioxidant mechanisms that control the cell’s response to oxidants. The purpose of the following article is to describe the function of sulforaphane.

Abstract

The KEAP1-Nrf2-ARE antioxidant system is a principal means by which cells respond to oxidative and xenobiotic stresses. Sulforaphane (SFN), an electrophilic isothiocyanate derived from cruciferous vegetables, activates the KEAP1-Nrf2-ARE pathway and has become a molecule-of-interest in the treatment of diseases in which chronic oxidative stress plays a major etiological role. We demonstrate here that the mitochondria of cultured, human retinal pigment epithelial (RPE-1) cells treated with SFN undergo hyperfusion that is independent of both Nrf2 and its cytoplasmic inhibitor KEAP1. Mitochondrial fusion has been reported to be cytoprotective by inhibiting pore formation in mitochondria during apoptosis, and consistent with this, we show Nrf2-independent, cytoprotection of SFN-treated cells exposed to the apoptosis-inducer, staurosporine. Mechanistically, SFN mitigates the recruitment and/or retention of the soluble fission factor Drp1 to mitochondria and to peroxisomes but does not affect overall Drp1 abundance. These data demonstrate that the beneficial properties of SFN extend beyond the activation of the KEAP1-Nrf2-ARE system and warrant further interrogation given the current use of this agent in multiple clinical trials.

Keywords: Sulforaphane, Nrf2, Drp1, Mitochondria, Fission, Fusion, Apoptosis

Introduction

Sulforaphane is an Nrf2-Independent Inhibitor of Mitochondrial Fission

Sulforaphane (SFN) is an isothiocyanate compound derived in the diet most commonly from cruciferous vegetables [56]. It is generated in plants as a xenobiotic response to predation via vesicular release of the hydrolytic enzyme myrosinase from damaged cells; this enzyme converts glucosinolates to isothiocyantes [42]. Over the last two decades, SFN has been extensively characterized for its reported anticancer, antioxidant, and antimicrobial properties [57]. Much of this efficacy has been attributed to the capacity of SFN to modulate the KEAP1-Nrf2-antioxidant response element (ARE) signaling pathway, although additional activities of the compound have been identified, including the inhibition of histone deacetylase activity and cell cycle progression [29]. Nrf2 is the master antioxidant transcription factor and under conditions of homeostasis, its stability is suppressed through the action of the cytoplasmic Cullin3KEAP1 ubiquitin ligase complex [20]. Specifically, Nrf2 is recruited to the Cullin3KEAP1 ligase by binding to the dimeric substrate adaptor KEAP1 and is subsequently modified with polyUb chains that target the transcription factor for proteasome-mediated degradation. This constitutive turnover limits the half-life of Nrf2 in unstressed cells to ~15 min [30], [33], [46], [55]. In response to numerous types of stress, most notably oxidative stress, KEAP1, a cysteine-rich protein, acts as a redox sensor, and oxidative modification of critical cysteines, particularly C151, of KEAP1 dissociates Nrf2-KEAP1 from CUL3 thereby preventing Nrf2 degradation [8], [20], [55]. Notably, SFN, and possibly other Nrf2 activators, mimic oxidative stress by modifying C151 of KEAP1 e.g. [21]. Stabilization of Nrf2 allows for its translocation to the nucleus where it induces the expression of a battery of Phase II antioxidant and detoxification genes. Nrf2 binds to the antioxidant response promoter elements (ARE) of its cognate target genes through heterodimerization with small Maf proteins [19]. This system presents a dynamic and sensitive response to indirect antioxidants like SFN, free radicals generated by the mitochondria [16], or other physiologic sources of oxidative stress [41].

Mitochondria are dynamic, subcellular organelles that regulate a host of cellular functions ranging from ATP production and intracellular calcium buffering to redox regulation and apoptosis [13], [49]. Mitochondria also represent the principal source of reactive oxygen species (ROS) within the cell. Proper regulation of mitochondrial function is therefore necessary for optimizing ATP production to meet cellular needs while simultaneously minimizing the potentially harmful effects of excessive free radical production. A critical requirement for fine modulation of mitochondrial function is the capacity for mitochondria to function both independently as biochemical machines and as part of a vast, responsive network.

Mitochondrial network morphology and function are determined by a regulated balance between fission and fusion. Mitochondrial fission is required for daughter cell inheritance of mitochondria during cell division [28] as well as for the selective, autophagic degradation of depolarized or damaged mitochondria, termed mitophagy [1]. Conversely, fusion is required for complementation of mitochondrial genomes and sharing of electron transport chain components between neighboring mitochondria [54]. At the molecular level, mitochondrial fission and fusion are regulated by large, dynamin-like GTPases. Three enzymes primarily regulate fusion: Mitofusins 1 and 2 (Mfn1/2) are two-pass outer membrane proteins that mediate outer membrane fusion via heterotypic interactions between adjacent mitochondria [15], [25], [37], while OPA1 is an inner membrane protein that simultaneously ensures matrix connectivity by regulating the melding of inner membranes [5]. The GTPase activity of all three proteins is required for robust fusion [5], [18], and OPA1 is further regulated by complex proteolysis within the mitochondrial inner membrane by the proteases OMA1 [14], PARL [6], and YME1L [45]. Importantly, intact mitochondrial membrane potential is required for efficient fusion in order to suppress integration of damaged and healthy mitochondria [26].

Mitochondrial fission is primarily catalyzed by a cytosolic protein called Dynamin-related protein 1 (Drp1/DNM1L). Drp1 is recruited from the cytosol to prospective sites of fission on the mitochondrial outer membrane [43]. The major receptors for Drp1 on the outer membrane are mitochondrial fission factor (Mff) [32] and, to a lesser extent, Fission 1 (Fis1) [51]. Additionally, a decoy receptor, MIEF1/MiD51, was discovered that acts to further limit the activity of Drp1 protein at potential fission sites [58]. Once docked at the mitochondrial outer membrane, Drp1 oligomerizes into spiral-like structures around the body of the mitochondrion and then utilizes the energy derived from GTP hydrolysis to mediate the physical scission of the mitochondrial outer and inner membranes [17]. Endoplasmic reticulum-derived tubules act as an initial constrictor of mitochondria prior to Drp1 oligomerization, underscoring the revelation that non-constricted mitochondria are wider than the permissive circumference of a completed Drp1 spiral [12]. Actin dynamics are also important for the ER-mitochondria interactions that precede mitochondrial fission [24]. In addition to its role in mitochondrial fission, Drp1 catalyzes the fission of peroxisomes [40].

Drp1 is very similar to the well-characterized dynamin protein in that both proteins contain an N-terminal GTPase domain, a Middle domain that is critical for self-oligomerization, and a C-terminal GTPase effector domain [31]. Drp1 achieves selectivity for mitochondrial membranes through a combination of interactions with its receptor proteins Mff and Fis1 and also through its affinity for the mitochondria-specific phospholipid cardiolipin via the unique B-insert domain of Drp1 [2]. Drp1 typically exists as a homotetramer in the cytoplasm, and higher order assembly at mitochondrial fission sites is mediated by the Middle domain of Drp1 [3].

Given the implicit link between mitochondrial function and the KEAP1-Nrf2-ARE pathway, we investigated the effects of Nrf2 activation on mitochondrial structure and function. We demonstrate here that SFN induces mitochondrial hyperfusion that, unexpectedly, is independent of both Nrf2 and KEAP1. This effect of SFN is through an inhibition of Drp1 function. We further demonstrate that SFN confers resistance to apoptosis that is Nrf2-independent and mimics that observed in cells depleted of Drp1. These data collectively indicate that in addition to stabilizing and activating Nrf2, SFN modulates mitochondrial dynamics and preserves cellular fitness and survival.

Results

Sulforaphane Induces Nrf2/KEAP1-Independent Hyperfusion of Mitochondria

In the course of studying the effects of Nrf2 activation on mitochondrial network dynamics, we discovered that treatment of immortalized, human retinal pigment epithelial (RPE-1) cells with sulforaphane (SFN), a potent activator of Nrf2 signaling, induced a robust fusion of the mitochondrial network when compared with vehicle-treated control cells (Fig. 1A and B). The morphology of the mitochondria in these cells greatly resembled that of the mitochondria in cells depleted by siRNA of endogenous Drp1, the principal mitochondrial fission factor (Fig. 1A). This result raised the intriguing idea that mitochondrial fission and fusion status responds directly to Nrf2 levels in the cell. However, stimulation of cells with other Nrf2 stabilizers and activators such as the proteasome inhibitor MG132, the pro-oxidant tBHQ, or knockdown of the Nrf2 inhibitor KEAP1 did not induce mitochondrial fusion (Fig. 1A and B). Stabilization of Nrf2 by these manipulations was confirmed by western blotting for endogenous Nrf2 (Fig. 1C). Furthermore, expression of Nrf2 was dispensable for SFN-induced mitochondrial fusion, as knockdown of endogenous Nrf2 with siRNA failed to counter this phenotype (Fig. 1D�F). Because SFN stimulates the KEAP1-Nrf2-ARE pathway by covalently modifying cysteine residues of KEAP1 [21], we knocked down KEAP1 to address whether SFN-induced mitochondrial hyperfusion is stimulated through a KEAP1-dependent, but Nrf2 independent pathway. However, depletion of KEAP1 also failed to abrogate SFN-induced mitochondrial fusion (Fig. 1G�I). In fact, SFN reversed the pro-fission morphology induced by depletion of KEAP1 (Fig. 1G, panel b versus panel d). These results indicate that SFN treatment causes mitochondrial fusion independent of the canonical KEAP1-Nrf2-ARE pathway and led us to interrogate whether SFN directly affects components of the mitochondrial fission or fusion machinery.

Figure 1 SFN induces Nrf2/KEAP1-independent mitochondrial fusion. (A) RPE-1 cells were transfected with the indicated siRNAs and 3 days later treated with DMSO or the Nrf2 activators SFN (50 ?M), MG132 (10 ?M), or tBHQ (100 ?M) for 4 h. Mitochondria (red) are labeled with an anti-Tom20 antibody, and nuclei (blue) are counterstained with DAPI. (B) Graph showing quantification of mitochondrial morphology scoring from (A). >50 cells per condition were evaluated in a blinded fashion. (C) Representative western blots from (A). (D) RPE-1 cells were transfected with 10 nM siRNA and 3 days later treated with SFN for 4 h prior to being fixed and stained as in (A). (E) Graph showing quantification of mitochondrial phenotype scoring from (D). >100 cells per condition were evaluated in a blinded fashion. (F) Representative western blots from (D). (G) Cells were transfected and treated as in (D) with siCON or siKEAP1. (H) Cells from (G) were scored as in (B) and (E) on the basis of mitochondrial morphology. (I) Representative western blots from (G). Data in (B), (E), and (H) were compiled from 3 independent experiments each and statistical significance was determined by two-tailed Student’s t-test. Error bars reflect +/- S.D. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).

Sulforaphane Impairs the Mitochondrial Association of Drp1

Based on the finding that SFN-treatment induces mitochondrial hyperfusion, we reasoned that this phenotype was either a consequence of excessive fusion activity or an inhibition of fission activity. To discriminate between these two possibilities, we compared the morphology of peroxisomes in the presence and absence of SFN. Peroxisomes are similar to mitochondria in that they are dynamic organelles the shape and length of which are constantly in flux [44]. Peroxisomes contain both Fis1 and Mff in their outer membrane and, as a consequence, are targets for Drp1-mediated fission [22], [23]. However, peroxisomes do not utilize the fusion machinery of the mitochondrial network and consequently, do not undergo fusion [39]. Rather, peroxisomal fission is opposed by the lengthening of existing peroxisomes via de novo addition of membranes and proteins [44]. Because peroxisomes lack Mfn1/2 and OPA1, we reasoned that if SFN activates the fusion machinery rather than inhibiting the fission machinery, peroxisome length would not be affected. In vehicle-treated cells, peroxisomes are maintained as short, round, punctiform organelles (Fig. 2, panels b and d). However, SFN treatment increased peroxisome length by ~2-fold as compared to control cells (Fig. 2, panels f and h). Furthermore, many of the peroxisomes were pinched near the center, indicating a potential scission defect (Fig. 2, panel h, arrowheads). Likewise, peroxisomes in cells transfected with Drp1 siRNA were abnormally long (Fig. 2, panels j and l), confirming that Drp1 is required for peroxisomal fission and suggesting that SFN-treatment causes mitochondrial and peroxisomal phenotypes by disrupting the fission machinery.

Figure 2 SFN induces peroxisomal lengthening. (A) RPE-1 cells were transfected with 10 nM of the indicated siRNA and 3 days later treated with DMSO or 50 ?M SFN for 4 h. Peroxisomes (green) were labeled with an anti-PMP70 antibody, mitochondria with MitoTracker (red), and DNA counterstained with DAPI. Enlarged insets of peroxisomes are shown on the right (panels d, h, and l) to facilitate visualization of the changes in morphology induced by SFN and Drp1 depletion. Arrowheads highlight constriction points. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).

We next determined how SFN restricts Drp1 function. Possibilities included reductions in expression levels, recruitment/retention at mitochondria, oligomerization, or enzymatic activity of the GTPase. A deficit in any one of these would result in reduced mitochondrial fission and hyperfusion. We did not detect reproducible changes in Drp1 protein levels after SFN-treatment (Figs. 1C and 3A), and therefore concluded that SFN does not alter Drp1 stability or expression, consistent with Drp1 having a half-life of >10 h [50] and our SFN treatments being of shorter duration. Next, we investigated whether SFN affected the recruitment or retention of Drp1 to mitochondria. Fractionation studies showed that SFN induced a loss of Drp1 from the mitochondrial fraction (Fig. 3A, lanes 7�8 and Fig. 3B). As reported previously [43], only a minor fraction of Drp1 (~3%) is associated with the mitochondrial network at any given time during steady state conditions with most of the enzyme residing in the cytoplasm (Fig. 3A, lanes 5�8). These fractionation data were confirmed using co-localization analysis which showed a ~40% reduction in mitochondria-localized, punctate Drp1 foci after SFN-treatment (Fig. 3C and D). Together, these data indicate that the mitochondrial fusion induced by SFN is, at least partially, due to the attenuated association of Drp1 with the mitochondria. Our data do not distinguish between whether SFN interferes with the mitochondrial recruitment versus the mitochondrial retention of Drp1, or both, as the analysis of endogenous Drp1 was not amenable to visualizing the GTPase by live-cell microscopy.

Figure 3 SFN causes a loss of Drp1 from the mitochondria. (A) Subcellular fractionation of RPE-1 cells following 4 h of DMSO or SFN. Whole-cell lysates (WCL), nuclear (Nuc), cytosolic (Cyto), and crude mitochondrial (Mito) fractions were resolved by SDS-PAGE and processed for western blotting with the indicated antibodies. The migration of molecular weight markers is indicated on the left. (B) Graphs showing densitometric quantification of Drp1 in the indicated fractions from (A). (C) RPE-1 cells were transfected with 10 nM siCON or siDrp1 and 3 days later treated with DMSO or SFN for 4 h. Drp1 (green) was visualized with an anti-Drp1 antibody, mitochondria with MitoTracker (red), and nuclei with DAPI (blue). (D) Automated co-localization analysis of Drp1 and MitoTracker signal from (C). Data in (B) and (D) were compiled from 3 and 5 independent experiments, respectively, and statistical significance was determined by two-tailed Student’s t-test. Error bars reflect +/- S.D and asterisks denote statistical significance. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).

Sulforaphane Confers Protection Against Staurosportine-Induced Apoptosis Independent of Nrf2

Previous work has shown that mitochondrial fission is permissive in the formation of pores in the outer mitochondrial membrane generated by Bax/Bak during apoptosis [11]. Drp1 has been shown to be selectively recruited to mitochondria during apoptosis [11] and, consistent with this, fragmented mitochondria have been observed early in the process [27]. Conversely, inhibiting mitochondrial fission is thought to inhibit apoptosis by blocking the formation of the outer membrane pores that allow for cytochrome c release [53]. Accordingly, stimulating mitochondrial fusion delays the progression of apoptosis induced by compounds including staurosporine (STS) [14]. To determine whether SFN protects RPE-1 cells from STS-mediated apoptosis and if so, whether this requires Nrf2, we established an assay to readily induce poly ADP ribose polymerase (PARP) cleavage, a substrate of activated caspase-3 and definitive marker of apoptosis. Treatment of RPE-1 cells with 1 �M STS for 6 h only caused a very modest cleavage of PARP yet this was prevented by SFN co-treatment (e.g., Fig. 4A, lane 3 versus 4). To increase the robustness of this assay, we further sensitized cells to STS-induced apoptosis by pre-treating them with siRNA targeting the anti-apoptotic factor, Bcl-XL. This pretreatment reduced the expression of Bcl-XL and markedly promoted PARP cleavage as a function of time exposed to STS (Fig. 4B, compare lane 2 to lanes 4�10). Importantly, 2 h of pre-treatment with SFN mitigated PARP cleavage in cells exposed to STS (Fig. 4C, lane 3 versus 4 and lane 5 versus 6). Likewise, cells stably depleted of Nrf2 by CRISPR/Cas9 were comparably protected from STS toxicity by SFN pre-treatment (Fig. 4C, lane 11 versus 12 and lane 13 versus 14 and Fig. 4D). This protection was observed using both PARP cleavage (Fig. 4C and D) and cellular morphology (Fig. 4E) as readouts. The efficacy of Nrf2 depletion by CRISPR/Cas9 was confirmed by western blotting (Fig. 4C, Nrf2 blot). As predicted, depleting cells of Drp1, which also yields a hyperfusion phenotype (Fig. 1A), also blocked PARP cleavage in response to STS as compared to control cells incubated with SFN (Fig. 4F and G). Together, these findings are consistent with SFN conferring protection against apoptosis through its capacity to restrict Drp1 function, independent of the stabilization and activation of Nrf2.

Figure 4 The cytoprotective effects of SFN are independent of Nrf2 expression (A) RPE-1 cells were pre-treated with DMSO or 50 ?M SFN for 2 h prior to treatment with DMSO, 1 ?M staurosporine (STS), or 50 ?M etoposide for 6 h and were processed for anti-PARP western blotting. (B) RPE-1 cells were transfected with 2.5 nM siCON, 1 nM siBcl-XL, or 2.5 nM siBcl-XL and 3 days later were treated with DMSO or 1 ?M STS for 2, 4, or 6 h. Representative western blots are shown and the migration of molecular weight markers is indicated on the left. (C) CRISPR/Cas9-generated wild-type (Nrf2WT) and Nrf2 knockout (Nrf2KO) RPE-1 cells were transfected with 1 nM siBcl-XL and 3 days later were pre-treated with DMSO or 50 ?M SFN for 2 h. Subsequently, the cells were treated with 1 ?M STS for 2, 4, or 6 h. Representative western blots with the indicated antibodies are shown. (D) Quantification of cleaved PARP as a percentage of total PARP (cleaved+uncleaved) from 3 independent experiments. Importantly, the levels of cleaved PARP were comparable whether cells expressed Nrf2 or not, indicating that SFN protection from STS is independent of the transcription factor. (E) 20X phase-contrast images taken immediately prior to harvest of lysates from (C). Scale bar=65 �m. (F) Representative western blots demonstrating that depletion of Drp1 confers near-comparable protection from STS as SFN treatment. RPE-1 cells were transfected with 1 nM siBcl-XL and additionally transfected with either 10 nM siCON or 10 nM siDrp1. 3 days later, siCON cells were pre-treated with SFN as in (A) and (C) and then exposed to STS for 4 h prior to being harvested and processed for western blotting with the indicated antibodies. (G) Same as (D) for the data presented in (F) compiled from 3 independent experiments. Error bars reflect +/- S.E.M.

Discussion

We have discovered that SFN modulates mitochondrial fission/fusion dynamics independent of its effects on the KEAP1-Nrf2-ARE pathway. This is intriguing because of an assumed link between mitochondrial dysfunction and ROS production and the necessity of squelching mitochondria-derived free radicals through the activation of Nrf2. This additional functional impact of SFN is of potential importance given the more than 30 clinical trials currently underway testing SFN for the treatment of a variety of diseases including prostate cancer, obstructive pulmonary disease, and sickle cell disease [7], [10], [47].

Because SFN is an isothiocyanate [56] and it activates Nrf2 signaling by directly acylating critical KEAP1 cysteines to suppress Nrf2 degradation [21], it follows that SFN exerts its pro-fusion effects by modulating the activity of a fission or fusion factor via cysteine modification. Our data strongly support Drp1 being negatively regulated by SFN although whether the GTPase is a direct target of acylation remains to be elucidated. Despite this knowledge gap, the function of Drp1 is clearly being compromised by SFN as both mitochondria and peroxisomes become hyperfused in response to SFN treatment and these organelles share Drp1 for their respective scission events [38]. In addition, SFN decreases the amount of Drp1 that localizes and accumulates at mitochondria (Fig. 3). Because our experiments were done with all endogenous proteins, our detection of Drp1 at mitochondrial fission sites is under steady-state conditions, and consequently, we cannot distinguish between a recruitment versus a retention defect of the enzyme caused by SFN. Further, we cannot eliminate the possibility that SFN acylates a receptor at the mitochondria (Fis1 or Mff) to block Drp1 recruitment yet, we suspect that Drp1 is directly modified. Drp1 has nine cysteines, eight of which reside within the Middle Domain that is required for oligomerization [3], and one of which resides in the GTPase Effector Domain (GED) at the C-terminus of Drp1. Direct acylation of any of these cysteines could cause an activity defect in Drp1 and therefore underlie the effect of SFN on mitochondrial dynamics. Notably, prior work suggests that defects in oligomerization and catalytic activity can abrogate the retention of Drp1 at the mitochondria [52]. Cys644 in the GED domain is a particularly attractive target based on previous work showing that mutation of this cysteine phenocopies mutations that impair Drp1 GTPase activity [4] and that this particular cysteine is modified by thiol-reactive electrophiles [9]. Resolution of this outstanding question will require mass spectrometric validation.In summary, we have identified a novel, cytoprotective function for the clinically-relevant compound SFN. In addition to activating the master anti-oxidant transcription factor Nrf2, SFN promotes mitochondrial and peroxisomal fusion, and this effect is independent of Nrf2. The mechanism underlying this phenomenon involves a reduction in the function of the GTPase Drp1, the primary mediator of mitochondrial and peroxisomal fission. A major consequence of SFN-mediated mitochondrial fusion is that cells become resistant to the toxic effects of the apoptosis inducer staurosporine. This additional cytoprotective action of SFN could be of particular clinical utility in the numerous neurodegenerative diseases for which age is the leading risk factor (e.g., Parkinson’s Disease, Alzheimer’s Disease, Age-related Macular Degeneration) as these maladies have been associated with apoptosis and reduced levels and/or dysregulation of Nrf2 [35], [36], [48]. Together, these data demonstrate that the cytoprotective properties of SFN extend beyond activation of the KEAP1-Nrf2-ARE system and warrant further studies given the current use of this agent in multiple clinical trials.

Materials and Methods

Apoptosis Assays

Cells were seeded and transfected with siRNA as indicated below. The cells were pre-treated with 50 ?M sulforaphane for 2 h to induce mitochondrial fusion and were then treated with 1 ?M staurosporine to induce apoptosis. At the time of harvest, media was collected in individual tubes and subjected to high speed centrifugation to pellet apoptotic cells. This cell pellet was combined with adherent cells and solubilized in 2 times-concentrated Laemmli buffer. Samples were subjected to anti-PARP western blotting.

CRISPR/Cas9 Construct Generation

To create LentiCRISPR/eCas9 1.1, LentiCRISPR v2 (addgene #52961) was first cut with Age1 and BamH1. Next, SpCas9 from eSpCas9 1.1 (addgene #71814) was PCR amplified with Age1 and BamH1 overhangs using the following primers (Forward AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, Reverse AAGCGCGGATCCCTTTTTCTTTTTTGCCTGGCCGG) and ligated into the cut vector above. sgRNA sequences were determined by using Benchling.com. Parameters were set to target the coding sequence with the highest on-target and lowest off-target scores. The following sequences (targeting sequence underlined, hs sgNFE2L2#1 sense CACCGCGACGGAAAGAGTATGAGC, antisense AAACGCTCATACTCTTTCCGTCGC; hs sgNFE2L2#2 sense CACCGGTTTCTGACTGGATGTGCT, antisense AAACAGCACATCCAGTCAGAAACC; hs sgNFE2L2#3 sense CACCGGAGTAGTTGGCAGATCCAC, antisense AAACGTGGATCTGCCAACTACTCC) were annealed and ligated into BsmB1 cut LentiCRISPR/eCas9 1.1. Lentivirally infected RPE-1 cells were selected with puromycin and maintained as a pooled population. Knockout was confirmed by immunofluorescence and western blotting.

Cell Culture and Transfections

Human retinal pigment epithelial cells transformed with telomerase (RPE-1) (ATCC) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) containing 1 g/L glucose supplemented with penicillin, streptomycin, 1X non-essential amino acid cocktail (Life Technologies), and 10% Fetal Bovine Serum (Life Technologies). For siRNA-transfections, 30,000�35,000 cells/mL were seeded overnight. Cells received 10 nM siRNA diluted in serum-free DMEM and combined with 0.3% Interferin transfection reagent (PolyPlus). For apoptosis sensitization, cells received 1 nM Bcl-XL siRNA. Cells were harvested 2�3 days post-transfection.

Chemicals, Antibodies, and siRNA Oligos

Antibodies against ?-tubulin (Cell Signaling), ?-tubulin (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (Cell Signaling), PMP70 (Abcam), and Tom20 (BD Biosciences) were used at 1:1000 dilutions for western blotting and for immunofluorescence. In-house, anti-Nrf2 rabbit antibody was used at 1:2000 for western blotting [34], [59]. Sulforaphane (Sigma) and staurosporine (Tocris) were used at 50 ?M and 1 ?M respectively. siRNAs against Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (Cell Signaling), and Bcl-XL (Cell Signaling) were used at 10 nM unless otherwise noted.

Immunofluorescence and in Vivo Labeling

Cells seeded on 18 mm glass coverslips were treated with vehicle or drug, fixed in 3.7% formaldehyde and then permeabilized in 0.2% Triton X-100/PBS on ice for 10 min. Primary antibodies were incubated in 3% bovine serum albumin (BSA) in PBS overnight at 4 �C. Following PBS washes, cells were incubated for 1 h in species-appropriate, Alexa488- or Alexa546-, conjugated secondary antibodies (diluted 1:1000) and 0.1 ?g/mL DAPI (Sigma) in 3% BSA/PBS. Mitochondria were visualized either by anti-Tom20 immunofluorescence or by incubating cells in 200 nM MitoTracker Red CMXRos (Molecular Probes, Inc.) in serum-free DMEM for 30 min at 37 �C prior to fixation.

Microscopy and Image Analysis

Immunofluorescence samples were viewed on an LSM710 Confocal microscope (Carl Zeiss). Micrographs were captured using 63X or 100X oil immersion objectives and images adjusted and enhanced using Adobe Photoshop CS6. Co-localization analysis was performed using Carl Zeiss LSM710 co-localization feature with thresholds manually set while blinded to the identity of the samples. Scale bars throughout, unless otherwise indicated, are 10 �m. Mitochondrial morphology was assessed by blinded scoring. If the mitochondria of a cell were maintained as multiple, round, discriminate puncta, the cell was scored as �fission�. If individual mitochondria were indistinguishable and the whole mitochondrial network appeared continuous, the cell was scored as �fusion�. All other cells, including those with clustering mitochondria, were scored as �intermediate�.

Subcellular Fractionations

RPE-1 cells were grown to confluence. Following a PBS wash, cells were subjected to centrifugation at 600�g for 10 min and resuspended in 600 ?L isolation buffer (210 mM Mannitol, 70 mM Sucrose, 5 mM MOPS, 1 mM EDTA pH 7.4+1 mM PMSF). The suspension was lysed 30 times in a Dounce homogenizer. A fraction of the homogenate was preserved as a �whole cell lysate.� The remainder was subjected to centrifugation at 800�g for 10 min to pellet nuclei. Supernatants were subjected to centrifugation at 1500�g for 10 min to clear remaining nuclei and unlysed cells. This supernatant was subjected to centrifugation at 15,000�g for 15 min to pellet mitochondria. The supernatant was preserved as the �cytosolic fraction�. The pellet was washed gently with PBS and resuspended in isolation buffer. The protein concentration of each fraction was measured by bicinchoninic acid (BCA) assay and equivalent amounts of protein were resolved by SDS-PAGE.

Western Blotting

Cells were washed in PBS and solubilized in 2 times concentrated Laemmli solubilizing buffer (100 mM Tris [pH 6.8], 2% SDS, 0.008% bromophenol blue, 2% 2-mercaptoethanol, 26.3% glycerol, and 0.001% Pyrinin Y). Lysates were boiled for 5 min prior to loading on sodium dodecyl sulfate (SDS) polyacrylamide gels. Proteins were transferred to nitrocellulose membranes and the membranes were blocked for 1 h in 5% Milk/TBST. Primary antibodies were diluted in 5% Milk/TBST and incubated with the blot overnight at 4 �C. Horseradish peroxidase (HRP)-conjugated secondary antibodies were diluted in 5% Milk/TBST. Blots were processed with enhanced chemiluminescence and densitometric quantifications were performed using ImageJ software.

Dr Jimenez White Coat

Sulforaphane is a chemical from the isothiocyanate collection of organosulfur substances obtained from cruciferous vegetables, including broccoli, cabbage, cauliflower, kale, and collards, among others. Sulforaphane is produced when the enzyme myrosinase transforms glucoraphanin, a glucosinolate, into sulforaphane, also known as sulforaphane-glucosinolate. Broccoli sprouts and cauliflower have the highest concentration of glucoraphanin or the precursor to sulforaphane. Research studies have demonstrated that sulforaphane enhances the human body’s antioxidant capabilities to prevent various health issues. Dr. Alex Jimenez D.C., C.C.S.T. Insight

Sulforaphane and Its Effects on Cancer, Mortality, Aging, Brain and Behavior, Heart Disease & More

Isothiocyanates are some of the most important plant compounds you can get in your diet. In this video I make the most comprehensive case for them that has ever been made. Short attention span? Skip to your favorite topic by clicking one of the time points below. Full timeline below.

Key sections:

  • 00:01:14 – Cancer and mortality
  • 00:19:04 – Aging
  • 00:26:30 – Brain and behavior
  • 00:38:06 – Final recap
  • 00:40:27 – Dose

Full timeline:

  • 00:00:34 – Introduction of sulforaphane, a major focus of the video.
  • 00:01:14 – Cruciferous vegetable consumption and reductions in all-cause mortality.
  • 00:02:12 – Prostate cancer risk.
  • 00:02:23 – Bladder cancer risk.
  • 00:02:34 – Lung cancer in smokers risk.
  • 00:02:48 – Breast cancer risk.
  • 00:03:13 – Hypothetical: what if you already have cancer? (interventional)
  • 00:03:35 – Plausible mechanism driving the cancer and mortality associative data.
  • 00:04:38 – Sulforaphane and cancer.
  • 00:05:32 – Animal evidence showing strong effect of broccoli sprout extract on bladder tumor development in rats.
  • 00:06:06 – Effect of direct supplementation of sulforaphane in prostate cancer patients.
  • 00:07:09 – Bioaccumulation of isothiocyanate metabolites in actual breast tissue.
  • 00:08:32 – Inhibition of breast cancer stem cells.
  • 00:08:53 – History lesson: brassicas were established as having health properties even in ancient Rome.
  • 00:09:16 – Sulforaphane’s ability to enhance carcinogen excretion (benzene, acrolein).
  • 00:09:51 – NRF2 as a genetic switch via antioxidant response elements.
  • 00:10:10 – How NRF2 activation enhances carcinogen excretion via glutathione-S-conjugates.
  • 00:10:34 – Brussels sprouts increase glutathione-S-transferase and reduce DNA damage.
  • 00:11:20 – Broccoli sprout drink increases benzene excretion by 61%.
  • 00:13:31 – Broccoli sprout homogenate increases antioxidant enzymes in the upper airway.
  • 00:15:45 – Cruciferous vegetable consumption and heart disease mortality.
  • 00:16:55 – Broccoli sprout powder improves blood lipids and overall heart disease risk in type 2 diabetics.
  • 00:19:04 – Beginning of aging section.
  • 00:19:21 – Sulforaphane-enriched diet enhances lifespan of beetles from 15 to 30% (in certain conditions).
  • 00:20:34 – Importance of low inflammation for longevity.
  • 00:22:05 – Cruciferous vegetables and broccoli sprout powder seem to reduce a wide variety of inflammatory markers in humans.
  • 00:23:40 – Mid-video recap: cancer, aging sections
  • 00:24:14 – Mouse studies suggest sulforaphane might improve adaptive immune function in old age.
  • 00:25:18 – Sulforaphane improved hair growth in a mouse model of balding. Picture at 00:26:10.
  • 00:26:30 – Beginning of brain and behavior section.
  • 00:27:18 – Effect of broccoli sprout extract on autism.
  • 00:27:48 – Effect of glucoraphanin on schizophrenia.
  • 00:28:17 – Start of depression discussion (plausible mechanism and studies).
  • 00:31:21 – Mouse study using 10 different models of stress-induced depression show sulforaphane similarly effective as fluoxetine (prozac).
  • 00:32:00 – Study shows direct ingestion of glucoraphanin in mice is similarly effective at preventing depression from social defeat stress model.
  • 00:33:01 – Beginning of neurodegeneration section.
  • 00:33:30 – Sulforaphane and Alzheimer’s disease.
  • 00:33:44 – Sulforaphane and Parkinson’s disease.
  • 00:33:51 – Sulforaphane and Hungtington’s disease.
  • 00:34:13 – Sulforaphane increases heat shock proteins.
  • 00:34:43 – Beginning of traumatic brain injury section.
  • 00:35:01 – Sulforaphane injected immediately after TBI improves memory (mouse study).
  • 00:35:55 – Sulforaphane and neuronal plasticity.
  • 00:36:32 – Sulforaphane improves learning in model of type II diabetes in mice.
  • 00:37:19 – Sulforaphane and duchenne muscular dystrophy.
  • 00:37:44 – Myostatin inhibition in muscle satellite cells (in vitro).
  • 00:38:06 – Late-video recap: mortality and cancer, DNA damage, oxidative stress and inflammation, benzene excretion, cardiovascular disease, type II diabetes, effects on the brain (depression, autism, schizophrenia, neurodegeneration), NRF2 pathway.
  • 00:40:27 – Thoughts on figuring out a dose of broccoli sprouts or sulforaphane.
  • 00:41:01 – Anecdotes on sprouting at home.
  • 00:43:14 – On cooking temperatures and sulforaphane activity.
  • 00:43:45 – Gut bacteria conversion of sulforaphane from glucoraphanin.
  • 00:44:24 – Supplements work better when combined with active myrosinase from vegetables.
  • 00:44:56 – Cooking techniques and cruciferous vegetables.
  • 00:46:06 – Isothiocyanates as goitrogens.

Acknowledgements

Sciencedirect.com/science/article/pii/S2213231716302750

How is Sulforaphane Produced?

Heating Decreases Epithiospecifier Protein Activity and Increases Sulforaphane Formation in Broccoli

Abstract

Sulforaphane, an isothiocyanate from broccoli, is one of the most potent food-derived anticarcinogens. This compound is not present in the intact vegetable, rather it is formed from its glucosinolate precursor, glucoraphanin, by the action of myrosinase, a thioglucosidase enzyme, when broccoli tissue is crushed or chewed. However, a number of studies have demonstrated that sulforaphane yield from glucoraphanin is low, and that a non-bioactive nitrile analog, sulforaphane nitrile, is the primary hydrolysis product when plant tissue is crushed at room temperature. Recent evidence suggests that in Arabidopsis, nitrile formation from glucosinolates is controlled by a heat-sensitive protein, epithiospecifier protein (ESP), a non-catalytic cofactor of myrosinase. Our objectives were to examine the effects of heating broccoli florets and sprouts on sulforaphane and sulforaphane nitrile formation, to determine if broccoli contains ESP activity, then to correlate heat-dependent changes in ESP activity, sulforaphane content and bioactivity, as measured by induction of the phase II detoxification enzyme quinone reductase (QR) in cell culture. Heating fresh broccoli florets or broccoli sprouts to 60 �C prior to homogenization simultaneously increased sulforaphane formation and decreased sulforaphane nitrile formation. A significant loss of ESP activity paralleled the decrease in sulforaphane nitrile formation. Heating to 70 �C and above decreased the formation of both products in broccoli florets, but not in broccoli sprouts. The induction of QR in cultured mouse hepatoma Hepa lclc7 cells paralleled increases in sulforaphane formation.

 

Pre-heating broccoli florets and sprouts to 60 �C significantly increased the myrosinase-catalyzed formation of sulforaphane (SF) in vegetable tissue extracts after crushing. This was associated with decreases in sulforaphane nitrile (SF Nitrile) formation and epithiospecifier protein (ESP) activity.

Keywords: Broccoli, Brassica oleracea, Cruciferae, Cancer, Anticarcinogen, Sulforaphane, Sulforaphane nitrile, Epithiospecifier protein, Quinone reductase

In conclusion, sulforaphane is a phytochemical found in broccoli,and other cruciferous vegetables. An uncontrolled amount of oxidants caused by both internal and external factors can cause oxidative stress in the human body which may ultimately lead to a variety of health issues. Sulforaphane can activate the production of Nrf2, a transcription factor that helps regulate�protective antioxidant mechanisms that control the cell’s response to oxidants. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.

Curated by Dr. Alex Jimenez

Referenced from: Sciencedirect.com

Green Call Now Button H .png

Additional Topic Discussion:�Acute Back Pain

Back pain�is one of the most prevalent causes of disability and missed days at work worldwide. Back pain attributes to the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments, and muscles, among other soft tissues. Because of this, injuries and/or aggravated conditions, such as�herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief.

blog picture of cartoon paper boy

EXTRA EXTRA | IMPORTANT TOPIC: Recommended El Paso, TX Chiropractor

***

The Emerging Role Of Nrf2 In Mitochondrial Function

The Emerging Role Of Nrf2 In Mitochondrial Function

Oxidants are generally produced in a controlled manner in order to regulate essential processes in the human body, including cell division, inflammation, immune function, autophagy, and stress response. However, the uncontrolled production of these oxidants can contribute to oxidative stress, which may affect cellular function, leading to the development of toxicity, chronic disease and cancer. The human body’s protective antioxidant mechanisms are regulated by a series of vital pathways that control the cell’s response to oxidants. The nuclear factor erythroid 2-related factor, otherwise known as Nrf2, is an emerging regulator of cellular resistance to oxidants. The purpose of the article below is to discuss and demonstrate the emerging role of Nrf2 in mitochondrial function.

Abstract

The transcription factor NF-E2 p45-related factor 2 (Nrf2; gene name NFE2L2) allows adaptation and survival under conditions of stress by regulating the gene expression of diverse networks of cytoprotective proteins, including antioxidant, anti-inflammatory, and detoxification enzymes as well as proteins that assist in the repair or removal of damaged macromolecules. Nrf2 has a crucial role in the maintenance of cellular redox homeostasis by regulating the biosynthesis, utilization, and regeneration of glutathione, thioredoxin, and NADPH and by controlling the production of reactive oxygen species by mitochondria and NADPH oxidase. Under homeostatic conditions, Nrf2 affects the mitochondrial membrane potential, fatty acid oxidation, availability of substrates (NADH and FADH2/succinate) for respiration, and ATP synthesis. Under conditions of stress or growth factor stimulation, activation of Nrf2 counteracts the increased reactive oxygen species production in mitochondria via transcriptional upregulation of uncoupling protein 3 and influences mitochondrial biogenesis by maintaining the levels of nuclear respiratory factor 1 and peroxisome proliferator-activated receptor ? coactivator 1?, as well as by promoting purine nucleotide biosynthesis. Pharmacological Nrf2 activators, such as the naturally occurring isothiocyanate sulforaphane, inhibit oxidant-mediated opening of the mitochondrial permeability transition pore and mitochondrial swelling. Curiously, a synthetic 1,4-diphenyl-1,2,3-triazole compound, originally designed as an Nrf2 activator, was found to promote mitophagy, thereby contributing to the overall mitochondrial homeostasis. Thus, Nrf2 is a prominent player in supporting the structural and functional integrity of the mitochondria, and this role is particularly crucial under conditions of stress.

Keywords: Bioenergetics, Cytoprotection, Keap1, Mitochondria, Nrf2, Free radicals

Highlights

  • Nrf2 has a crucial role in maintaining cellular redox homeostasis.
  • Nrf2 affects the mitochondrial membrane potential and ATP synthesis.
  • Nrf2 influences mitochondrial fatty acid oxidation.
  • Nrf2 supports the structural and functional integrity of the mitochondria.
  • Nrf2 activators have beneficial effects when mitochondrial function is compromised.

Introduction

The transcription factor NF-E2 p45-related factor 2 (Nrf2; gene name NFE2L2) regulates the expression of networks of genes encoding proteins with diverse cytoprotective activities. Nrf2 itself is controlled primarily at the level of protein stability. Under basal conditions, Nrf2 is a short-lived protein that is subjected to continuous ubiquitination and proteasomal degradation. There are three known ubiquitin ligase systems that contribute to the degradation of Nrf2. Historically, the first negative regulator of Nrf2 to be discovered was Kelch-like ECH-associated protein 1 (Keap1) [1], a substrate adaptor protein for Cullin 3 (Cul3)/Rbx1 ubiquitin ligase [2], [3], [4]. Keap1 uses a highly efficient cyclic mechanism to target Nrf2 for ubiquitination and proteasomal degradation, during which Keap1 is continuously regenerated, allowing the cycle to proceed (Fig. 1A) [5]. Nrf2 is also subjected to degradation mediated by glycogen synthase kinase (GSK)3/?-TrCP-dependent Cul1-based ubiquitin ligase [6], [7]. Most recently, it was reported that, during conditions of endoplasmic reticulum stress, Nrf2 is ubiquitinated and degraded in a process mediated by the E3 ubiquitin ligase Hrd1 [8].

Figure 1 The cyclic sequential binding and regeneration model for Keap1-mediated degradation of Nrf2. (A) Nrf2 binds sequentially to a free Keap1 dimer: first through its high-affinity ETGE (red sticks) binding domain and then through its low-affinity DLG (black sticks) binding domain. In this conformation of the protein complex, Nrf2 undergoes ubiquitination and is targeted for proteasomal degradation. Free Keap1 is regenerated and able to bind to newly translated Nrf2, and the cycle begins again.(B) Inducers (white diamonds) react with sensor cysteines of Keap1 (blue sticks), leading to a conformational change and impaired substrate adaptor activity. Free Keap1 is not regenerated, and the newly synthesized Nrf2 accumulates and translocates to the nucleus.

In addition to serving as a ubiquitin ligase substrate adaptor protein, Keap1 is also the sensor for a wide array of small-molecule activators of Nrf2 (termed inducers) [9]. Inducers block the cycle of Keap1-mediated degradation of Nrf2 by chemically modifying specific cysteine residues within Keap1 [10], [11] or by directly disrupting the Keap1:Nrf2 binding interface [12], [13]. Consequently, Nrf2 is not degraded, and the transcription factor accumulates and translocates to the nucleus (Fig. 1B), where it forms a heterodimer with a small Maf protein; binds to antioxidant-response elements, the upstream regulatory regions of its target genes; and initiates transcription [14], [15], [16]. The battery of Nrf2 targets comprises proteins with diverse cytoprotective functions, including enzymes of xenobiotic metabolism, proteins with antioxidant and anti-inflammatory functions, and proteasomal subunits, as well as proteins that regulate cellular redox homeostasis and participate in intermediary metabolism.

Nrf2: a Master Regulator of Cellular Redox Homeostasis

The function of Nrf2 as a master regulator of cellular redox homeostasis is widely recognized. The gene expression of both the catalytic and the regulatory subunits of ?-glutamyl cysteine ligase, the enzyme catalyzing the rate-limiting step in the biosynthesis of reduced glutathione (GSH), is directly regulated by Nrf2 [17]. The xCT subunit of system xc-, which imports cystine into cells, is also a direct transcriptional target of Nrf2 [18]. In the cell, cystine undergoes conversion to cysteine, a precursor for the biosynthesis of GSH. In addition to its role in GSH biosynthesis, Nrf2 provides the means for the maintenance of glutathione in its reduced state by the coordinated transcriptional regulation of glutathione reductase 1 [19], [20], which reduces oxidized glutathione to GSH using reducing equivalents from NADPH. The required NADPH is provided by four principal NADPH-generating enzymes, malic enzyme 1 (ME1), isocitrate dehydrogenase 1 (IDH1), glucose-6-phosphate dehydrogenase (G6PD), and 6-phosphogluconate dehydrogenase (PGD), all of which are transcriptionally regulated in part by Nrf2 (Fig. 2) [21], [22], [23], [24]. Curiously, Nrf2 also regulates the inducible gene expression of the cytosolic, microsomal, and mitochondrial forms of aldehyde dehydrogenase [25], which use NAD(P)+ as a cofactor, giving rise to NAD(P)H. Indeed, the levels of NADPH and the NADPH/NADP+ ratio are lower in embryonic fibroblasts isolated from Nrf2-knockout (Nrf2-KO) mice compared to cells from their wild-type (WT) counterparts, and the NADPH levels decrease upon Nrf2 knockdown in cancer cell lines with constitutively active Nrf2 [26]. As expected, the levels of GSH are lower in cells in which Nrf2 has been disrupted; conversely, Nrf2 activation by genetic or pharmacological means leads to GSH upregulation [27], [28], [29]. Importantly, Nrf2 also regulates the gene expression of thioredoxin [30], [31], [32], thioredoxin reductase 1 [28], [29], [32], [33], and sulfiredoxin [34], which are essential for the reduction of oxidized protein thiols.

Figure 2 The role of Nrf2 in the metabolism of rapidly proliferating cells. Nrf2 is a positive regulator of genes encoding enzymes in both the oxidative arm [i.e., glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD)] and the nonoxidative arm [i.e., transaldolase 1 (TALDO1) and transketolase (TKT)] of the pentose phosphate pathway. G6PD and PGD generate NADPH. Nrf2 also regulates the gene expression of the other two NADPH-generating enzymes, malic enzyme 1 (ME1) and isocitrate dehydrogenase 1 (IDH1). The gene expression of phosphoribosyl pyrophosphate amidotransferase (PPAT), which catalyzes the entry into the de novo purine biosynthetic pathway, is also positively regulated by Nrf2, as is the expression of methylenetetrahydrofolate dehydrogenase 2 (MTHFD2), a mitochondrial enzyme with a critical role in providing one-carbon units for de novo purine biosynthesis. Pyruvate kinase (PK) is negatively regulated by Nrf2 and is expected to favor the buildup of glycolytic intermediates and, together with G6PD, metabolite channeling through the pentose phosphate pathway and the synthesis of nucleic acids, amino acids, and phospholipids. Nrf2 negatively regulates the gene expression of ATP-citrate lyase (CL), which may increase the availability of citrate for mitochondrial utilization or (through isocitrate) for IDH1. Red and blue indicate positive and negative regulation, respectively. The mitochondrion is shown in gray. Metabolite abbreviations: G-6-P, glucose 6-phosphate; F-6-P, fructose 6-phosphate; F-1,6-BP, fructose 1,6-bisphosphate; GA-3-P, glyceraldehyde 3-phosphate; 3-PG, 3-phosphoglycerate; PEP, phosphoenolpyruvate; 6-P-Gl, 6-phosphogluconolactone; 6-PG, 6-phosphogluconate; R-5-P, ribulose 5-phosphate; PRPP, 5-phosphoribosyl-?-1-pyrophosphate; THF, tetrahydrofolate; IMP, inosine monophosphate; AMP, adenosine monophosphate; GMP, guanosine monophosphate.

Given the crucial role of Nrf2 as a master regulator of cellular redox homeostasis, it is not surprising that, compared to WT cells, the levels of reactive oxygen species (ROS) are higher in cells in which Nrf2 has been disrupted (Nrf2-KO) [35]. This difference is particularly striking upon challenge with agents causing oxidative stress. Moreover, cells deficient in Nrf2 are much more sensitive to the toxicity of oxidants of various types and cannot be protected by Nrf2 inducers, which, under the same conditions, provide efficient and long-lasting protection to WT cells [29], [36], [37]. In addition to the overall cellular redox homeostasis, Nrf2 is also critical for the maintenance of the mitochondrial redox homeostasis. Thus, compared to WT, the total mitochondrial NADH pool is significantly increased in Keap1-KO and dramatically decreased in Nrf2-KO cells [35].

Using live cell imaging, we recently monitored the rates of ROS production in primary glioneuronal cocultures and brain tissue slices isolated from WT, Nrf2-KO, or Keap1-knockdown (Keap1-KD) mice [38]. As expected, the rate of ROS production was faster in Nrf2-KO cells and tissues compared to their WT counterparts. However, we made the unexpected observation that, compared to WT, Keap1-KD cells also have higher rates of ROS production, although the magnitude of the difference between the WT and the Keap1-KD genotypes was smaller than that between WT and Nrf2-KO. We then analyzed the mRNA levels of NOX2 and NOX4, the catalytic subunits of the two NADPH oxidase (NOX) isoforms that have been implicated in brain pathology, and found that NOX2 is dramatically increased under conditions of Nrf2 deficiency, whereas NOX4 is upregulated when Nrf2 is constitutively activated, although to a smaller extent. Quantitatively, the magnitude of upregulation in cells and tissues from the mutant mice parallels the corresponding increases in ROS production [38]. Interestingly, not only does Nrf2 regulate NADPH oxidase, but the ROS produced by NADPH oxidase can activate Nrf2, as shown in pulmonary epithelial cells and cardiomyocytes [39], [40]. Furthermore, a very recent study has demonstrated that the NADPH oxidase-dependent activation of Nrf2 constitutes an important endogenous mechanism for protection against mitochondrial damage and cell death in the heart during chronic pressure overload [41].

In addition to the catalytic activity of NADPH oxidase, mitochondrial respiration is another major intracellular source of ROS.By use of the mitochondria-specific probe MitoSOX, we have examined the contribution of ROS of mitochondrial origin to the overall ROS production in primary glioneuronal cocultures isolated from WT, Nrf2-KO, or Keap1-KD mice [38]. As expected, Nrf2-KO cells had higher rates of mitochondrial ROS production than WT. In agreement with the findings for the overall ROS production, the rates of mitochondrial ROS production in Keap1-KD were also higher compared to WT cells. Importantly, blocking complex I with rotenone caused a dramatic increase in mitochondrial ROS production in both WT and Keap1-KD cells, but had no effect in Nrf2-KO cells. In contrast to the expected increase in mitochondrial ROS production in WT cells after addition of pyruvate (to enhance the availability of NADH, increase the mitochondrial membrane potential,and normalize respiration), the production of ROS decreased in Nrf2-KO cells. Together, these findings strongly suggest that, in the absence of Nrf2: (i) the activity of complex I is impaired, (ii) the impaired activity of complex I is due to limitation of substrates, and (iii) the impaired activity of complex I is one of the main reasons for the increased mitochondrial ROS production, possibly owing to reverse electron flow from complex II.

Nrf2 Affects Mitochondrial Membrane Potential and Respiration

The mitochondrial membrane potential (??m) is a universal indicator of mitochondrial health and the metabolic state of the cell. In a healthy cell, ??m is maintained by the mitochondrial respiratory chain. Interestingly, a stable isotopic labeling with amino acids in culture-based proteomics study in the estrogen receptor-negative nontumorigenic human breast epithelial MCF10A cell line has shown that the mitochondrial electron transport chain component NDUFA4 is upregulated by pharmacological activation (by sulforaphane) of Nrf2, whereas genetic upregulation of Nrf2 (by Keap1 knockdown) leads to downregulation of the cytochrome c oxidase subunits COX2 and COX4I1 [42]. A study of the liver proteome using two-dimensional gel electrophoresis and matrix-assisted laser desorption/ionization mass spectrometry has found that Nrf2 regulates the expression of ATP synthase subunit ? [43]. In addition, the mitochondrial protein DJ-1, which plays a role in the maintenance of the activity of complex I [44], has been reported to stabilize Nrf2 [45], [46], although the neuroprotective effects of pharmacological or genetic activation of Nrf2 are independent of DJ-1 [47]. However, the consequences of these observations for mitochondrial function have not been investigated.

In agreement with the impaired activity of complex I under conditions of Nrf2 deficiency, the basal ??m is lower in Nrf2-KO mouse embryonic fibroblasts (MEFs) and cultured primary glioneuronal cells in comparison with their WT counterparts (Fig. 3,inset) [35]. In contrast, the basal ??m is higher when Nrf2 is genetically constitutively upregulated (by knockdown or knockout of Keap1). These differences in ??m among the genotypes indicate that respiration is affected by the activity of Nrf2. Indeed, evaluation of the oxygen consumption in the basal state has revealed that, compared to WT, the oxygen consumption is lower in Nrf2-KO and Keap1-KO MEFs, by ~50 and ~35%, respectively.

Figure 3 Proposed mechanism for compromised mitochondrial function under conditions of Nrf2 deficiency. (1) The decreased levels of ME1, IDH1, G6PD, and PGD result in lower NADPH levels. (2) The levels of GSH are also low. (3) The low activity of ME1 may decrease the pool of pyruvate entering the mitochondria. (4) The generation of NADH is slower, leading to impaired activity of complex I and increased mitochondrial ROS production. (5) The reduction of FAD to FADH2 in mitochondrial proteins is also decreased, lowering the electron flow from FADH2 to UbQ and into complex III. (6) The slower formation of UbQH2 may lower the enzyme activity of succinate dehydrogenase. (7) The increased levels of ROS may further inhibit the activity of complex II. (8) The lower efficiency of fatty acid oxidation contributes to the decreased substrate availability for mitochondrial respiration. (9) Glycolysis is enhanced as a compensatory mechanism for the decreased ATP production in oxidative phosphorylation. (10) ATP synthase operates in reverse to maintain ??m. Red and blue indicate upregulation and downregulation, respectively. The boxes signify availability of experimental evidence. The inset shows images of mitochondria of WT and Nrf2-KO cortical astrocytes visualized by the potentiometric fluorescent probe tetramethylrhodamine methyl ester (TMRM; 25 nM). Scale bar, 20 �m.

These differences in ??m and respiration among the genotypes are reflected by the rate of utilization of substrates for mitochondrial respiration. Application of substrates for the tricarboxylic acid (TCA) cycle (malate/pyruvate, which in turn increase the production of the complex I substrate NADH) or methyl succinate, a substrate for complex II, causes a stepwise increase in ??m in both WT and Keap1-KD neurons, but the rate of increase is higher in Keap1-KD cells. More importantly, the shapes of the response to these TCA cycle substrates are different between the two genotypes, whereby the rapid rise in ??m in Keap1-KD cells upon substrate addition is followed by a quick drop rather than a plateau, suggesting an unusually fast substrate consumption. These findings are in close agreement with the much lower (by 50�70%) levels of malate, pyruvate, and succinate that have been observed after a 1-h pulse of [U-13C6]glucose in Keap1-KO compared to WT MEF cells [24]. In Nrf2-KO neurons, only pyruvate is able to increase the ??m, whereas malate and methyl succinate cause mild depolarization. The effect of Nrf2 on mitochondrial substrate production seems to be the main mechanism by which Nrf2 affects mitochondrial function. The mitochondrial NADH redox index (the balance between consumption of NADH by complex I and production of NADPH in the TCA cycle) is significantly lower in Nrf2-KO cells in comparison with their WT counterparts, and furthermore, the rates of regeneration of the pools of NADH and FADH2 after inhibition of complex IV (by use of NaCN) are slower in the mutant cells.

In mitochondria isolated from murine brain and liver, supplementation of substrates for complex I or for complex II increases the rate of oxygen consumption more strongly when Nrf2 is activated and less efficiently when Nrf2 is disrupted [35]. Thus, malate induces a higher rate of oxygen consumption in Keap1-KD compared to WT, but its effect is weaker in Nrf2-KO mitochondria. Similarly, in the presence of rotenone (when complex I is inhibited), succinate activates oxygen consumption to a greater extent in Keap1-KD compared to WT, whereas the response in Nrf2-KO mitochondria is diminished. In addition, Nrf2-KO primary neuronal cultures and mice are more sensitive to the toxicity of the complex II inhibitors 3-nitropropionic acid and malonate, whereas intrastriatal transplantation of Nrf2-overexpressing astrocytes is protective [48], [49]. Similarly, Nrf2-KO mice are more sensitive to, whereas genetic or pharmacological activation of Nrf2 has protective effects against, neurotoxicity caused by the complex I inhibitor 1-methyl-4-phenylpyridinium ion in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine animal model of Parkinson?s disease [49], [50], [51], [52], [53], [54], [55], [56], [57], [58], [59], [60], [61].

The respiratory control ratio (RCR), the ratio of State 3 (ADP-stimulated) to State 4 respiration (no ADP present), is decreased in the absence of Nrf2, but the RCR is similar between Keap1-KD and WT mitochondria [35]. As the RCR is an indication of the degree of coupling of the mitochondrial respiratory chain activity to oxidative phosphorylation, this finding indicates that the higher rate of respiration in Keap1-KD mitochondria is not due to uncoupling of oxidative phosphorylation. It further suggests that oxidative phosphorylation is more efficient when Nrf2 is activated. The higher rate of respiration in Keap1-KD mitochondria is consistent with the higher levels of mitochondrial ROS production [38] as higher respiration rates may lead to increased electron leak. However, under conditions of oxidative stress, the increased ROS production is counteracted by the Nrf2-dependent transcriptional upregulation of uncoupling protein 3 (UCP3), which increases the proton conductance of the mitochondrial inner membrane and consequently decreases the production of superoxide [62]. Very recently, it was shown that the lipid peroxidation product 4-hydroxy-2-nonenal mediates the Nrf2-dependent upregulation of UCP3 in cardiomyocytes; this might be particularly important for protection under conditions of oxidative stress such as those during ischemia�reperfusion [63].

Nrf2 Affects the Efficiency of Oxidative Phosphorylation and the Synthesis of ATP

In agreement with the effect of Nrf2 on respiration, in brain and liver mitochondria, Nrf2 deficiency results in a decreased efficiency of oxidative phosphorylation (as estimated by the ratio of ADP to oxygen, which is consumed for ATP synthesis), whereas Nrf2 activation (Keap1-KD) has the opposite effect [35]. Compared to WT, the ATP levels are significantly higher in cells with constitutive upregulation of Nrf2 and lower when Nrf2 is knocked down [64] or disrupted [35]. Furthermore, the use of inhibitors of oxidative phosphorylation (oligomycin) or glycolysis (iodoacetic acid) has revealed that Nrf2 changes the way by which cells produce ATP. Thus, in WT neurons, oligomycin causes a complete drop in ATP and iodoacetic acid has no further effect. Remarkably, in Nrf2-KO cells, oligomycin increases the ATP levels, which are then slowly, but completely, depleted by iodoacetic acid, indicating that in the absence of Nrf2, glycolysis, and not oxidative phosphorylation, is the main source of ATP production. Interestingly, despite the increased efficiency of oxidative phosphorylation in Keap1-KD cells, addition of oligomycin results in an ~80% decrease in ATP levels, and iodoacetic acid causes a further ~20% decrease. Thus, either Nrf2 deficiency or its constitutive activation reduces the contribution of oxidative phosphorylation and increases the contribution of glycolysis toward the synthesis of ATP. This effect is particularly pronounced when Nrf2 is absent and is consistent with the dependence of the ??m on the presence of glucose in the medium [35] and the increased levels of glycolytic intermediates (G-6-P, F-6-P, dihydroxyacetone phosphate, pyruvate, and lactate) after knockdown of Nrf2 [24].

The increase in ATP levels after inhibition of the F1F0-ATPase by oligomycin indicates that in the absence of Nrf2, the F1F0-ATPase functions as an ATPase and not an ATP synthase, i.e., it operates in reverse. Such reversal in activity most likely reflects the need to pump protons across the inner mitochondrial membrane in an attempt to maintain the ??m, which is crucial for the functional integrity of this organelle. The reversal of the function of the F1F0-ATPase is also evidenced by the observed mitochondrial depolarization upon oligomycin administration to Nrf2-KO cells, which is in sharp contrast to the hyperpolarization occurring in their WT or Keap1-deficient counterparts [35]. Overall, it seems that under conditions of Nrf2 deficiency ATP is produced primarily in glycolysis, and this ATP is then used in part by the F1F0-ATPase to maintain the ??m.

Nrf2 Enhances Mitochondrial Fatty Acid Oxidation

The effect of Nrf2 deficiency on the ??m is particularly pronounced when cells are incubated in medium without glucose, and the ??m is ~50% lower in Nrf2-KO compared to WT cells [35]. Under conditions of glucose deprivation, mitochondrial fatty acid oxidation (FAO) is a major provider of substrates for respiration and oxidative phosphorylation, suggesting that Nrf2 may affect FAO. Indeed, the efficiency of FAO for both the long-chain (C16:0) saturated fatty acid palmitic acid and the short-chain (C6:0) hexanoic acid is higher in Keap1-KO MEFs and isolated heart and liver mitochondria than in their WT counterparts, whereas it is lower in Nrf2-KO cells and mitochondria [65]. These effects are also highly relevant to humans: indeed, metabolic changes indicative of better integration of FAO with the activity of the TCA cycle have been reported to occur in human intervention studies with diets rich in glucoraphanin, the precursor of the classical Nrf2 activator sulforaphane [66].

During the first step of mitochondrial FAO, the pro-R hydrogen of the ?-carbon leaves as a hydride that reduces the FAD cofactor to FADH2, which in turn transfers electrons to ubiquinone (UbQ) in the respiratory chain, ultimately contributing to ATP production. Whereas stimulation of FAO by palmitoylcarnitine in the absence of glucose causes the expected increase in the ATP levels in WT and Keap1-KO cells, with the ATP rise being faster in Keap1-KO cells, the identical treatment produces no ATP changes in Nrf2-KO MEFs [65]. This experiment demonstrates that, in the absence of Nrf2, FAO is suppressed, and furthermore, it implicates suppression of FAO as one of the reasons for the lower ATP levels under conditions of Nrf2 deficiency [35], [64].

Notably, human 293 T cells in which Nrf2 has been silenced have a lower expression of CPT1 and CPT2[67], two isoforms of carnitine palmitoyltransferase (CPT), the rate-limiting enzyme in mitochondrial FAO. In agreement, the mRNA levels of Cpt1 are lower in livers of Nrf2-KO compared to WT mice [68]. CPT catalyzes the transfer of the acyl group of a long-chain fatty acyl-CoA from coenzyme A to l-carnitine and thus permits the import of acylcarnitine from the cytoplasm into the mitochondria. Although this has not been examined to date, it is possible that in addition to the transcriptional effects on CPT1 expression, Nrf2 may also affect the function of this enzyme by controlling the levels of its main allosteric inhibitor, malonyl-CoA. This is because, by a mechanism that is currently unclear, Nrf2 regulates negatively the expression of stearoyl CoA desaturase (SCD) [69] and citrate lyase (CL) [69], [70]. Curiously, knockout or inhibition of SCD leads to increased phosphorylation and activation of AMP-activated protein kinase (AMPK) [71], [72], [73], and it can be speculated that, in the absence of Nrf2, the SCD levels will increase, in turn lowering AMPK activity. This could be further compounded by the reduced protein levels of AMPK that have been observed in livers of Nrf2-KO mice [68], a finding that is in close agreement with the increased AMPK levels, which have been reported in livers of Keap1-KD mice [74]. One consequence of the decreased AMPK activity is the relief of its inhibitory phosphorylation (at Ser79) of acetyl-CoA carboxylase (ACC) [75], which could be further transcriptionally upregulated in the absence of Nrf2 because it is downregulated by Nrf2 activation [70]. The high ACC activity, in combination with the upregulated CL expression that will increase the production of acetyl-CoA, the substrate for ACC, may ultimately increase the levels of the ACC product, malonyl-CoA. The high levels of malonyl-CoA will inhibit CPT, thereby decreasing the transport of fatty acids into the mitochondria. Finally, Nrf2 positively regulates the expression of CD36 [76], a translocase that imports fatty acids across plasma and mitochondrial membranes. Thus, one mechanism by which Nrf2 may affect the efficiency of mitochondrial FAO is by regulating the import of long-chain fatty acids into the mitochondria.

In addition to direct transcriptional regulation, Nrf2 may also alter the efficiency of mitochondrial FAO by its effects on the cellular redox metabolism. This may be especially relevant when Nrf2 activity is low or absent, conditions that shift the cellular redox status toward the oxidized state. Indeed, several FAO enzymes have been identified as being sensitive to redox changes. One such enzyme is very long-chain acyl-CoA dehydrogenase (VLCAD), which contributes more than 80% to the palmitoyl-CoA dehydrogenation activity in human tissues [77]. Interestingly, Hurd et al. [78] have shown that VLCAD contains cysteine residues that significantly change their redox state upon exposure of isolated rat heart mitochondria to H2O2. Additionally, S-nitrosylation of murine hepatic VLCAD at Cys238 improves the catalytic efficiency of the enzyme [79], and it is likely that oxidation of the same cysteine may have the opposite effect, ultimately lowering the efficiency of mitochondrial FAO. It is therefore possible that, although the expression levels of VLCAD are not significantly different in WT, Nrf2-KO, or Keap1-KO MEFs [65], the enzyme activity of VLCAD could be lower in the absence of Nrf2 owing to the higher levels of ROS.

Based on all of these findings, it can be proposed that (Fig. 3): in the absence of Nrf2, the NADPH levels are lower owing to decreased expression of ME1, IDH1, G6PD, and PGD. The levels of reduced glutathione are also lower owing to decreased expression of enzymes that participate in its biosynthesis and regeneration and the lower levels of NADPH that are required for the conversion of the oxidized to the reduced form of glutathione. The low expression of ME1 will decrease the pool of pyruvate entering the mitochondria, with glycolysis becoming the major source of pyruvate. The generation of NADH is slower, leading to impaired activity of complex I and increased mitochondrial ROS production. The reduction of FAD to FADH2 is also slower, at least in part owing to less efficient fatty acid oxidation, compromising the electron flow from FADH2 to UbQ and into complex III. As UbQH2 is an activator of succinate dehydrogenase [80], slowing down its formation may lower the enzyme activity of succinate dehydrogenase. The increased levels of superoxide and hydrogen peroxide can inhibit complex II activity further [81]. The lower efficiency of fatty acid oxidation contributes to the decreased substrate availability for mitochondrial respiration and ATP production in oxidative phosphorylation. As a compensatory mechanism, glycolysis is enhanced. ATP synthase functions in reverse, as an ATPase, in an attempt to maintain the ??m.

Nrf2 and Mitochondrial Biogenesis

It has been reported that, compared to WT, the livers of Nrf2-KO mice have a lower mitochondrial content (as determined by the ratio of mitochondrial to nuclear DNA); this is further decreased by a 24-h fast in both WT and Nrf2-KO mice; in contrast, although no different from WT under normal feeding conditions, the mitochondrial content in mice with high Nrf2 activity is not affected by fasting [82]. Interestingly, supplementation with the Nrf2 activator (R)-?-lipoic acid [83], [84], [85] promotes mitochondrial biogenesis in 3T3-L1 adipocytes [86]. Two classes of nuclear transcriptional regulators play critical roles in mitochondrial biogenesis. The first class are transcription factors, such as nuclear respiratory factors11 and 2, which control the expression of genes encoding subunits of the five respiratory complexes, mitochondrial translational components, and heme biosynthetic enzymes that are localized to the mitochondrial matrix [88]. Piantadosi et al. [89] have shown that the Nrf2-dependent transcriptional upregulation of nuclear respiratory factor 1 promotes mitochondrial biogenesis and protects against the cytotoxicity of the cardiotoxic anthracycline chemotherapeutic agent doxorubicin. In contrast, Zhang et al. [82] have reported that genetic activation of Nrf2 does not affect the basal mRNA expression of nuclear respiratory factor 1 in the murine liver.

The second class of nuclear transcriptional regulators with critical functions in mitochondrial biogenesis are transcriptional coactivators, such as peroxisome proliferator-activated receptor ? coactivators (PGC)1? and 1?, which interact with transcription factors, the basal transcriptional and RNA-splicing machinery, and histone-modifying enzymes [88], [90], [91]. The expression of the PGC1 family of coactivators is influenced by numerous environmental signals. Treatment of human fibroblasts with the Nrf2 activator sulforaphane causes an increase in mitochondrial mass and induction of PGC1? and PGC1? [92], although the potential dependence on Nrf2 was not examined in this study. However, diabetic mice in which Nrf2 is either activated by Keap1 gene hypomorphic knockdown (db/db:Keap1flox/?:Nrf2+/+) or disrupted (db/db:Keap1flox/?:Nrf2?/?) have lower hepatic PGC1? expression levels than control animals (db/db:Keap1flox/+:Nrf2+/+) [93]. No differences in the mRNA levels for PGC1? are seen in livers of nondiabetic mice that are either WT or Nrf2-KO, whereas these levels are lower in Nrf2-overexpressing (Keap1-KD and liver-specific Keap1-KO) animals [82]. Notably, a 24-h fast increases the levels of PGC1? mRNA in the livers of mice of all genotypes, but the increase is significantly greater in livers of Nrf2-KO compared to WT or Nrf2-overexpressing mice. Compared to WT, Nrf2-KO mice experiencing septic infection or acute lung injury due to infection show attenuated transcriptional upregulation of nuclear respiratory factor 1 and PGC1? [94], [95]. Together, these observations suggest that the role of Nrf2 in maintaining the levels of both nuclear respiratory factor 1 and PGC1? is complex and becomes most prominent under conditions of stress.

In addition to expression of genes encoding mitochondrial proteins, mitochondrial biogenesis requires the synthesis of nucleotides. Genetic activation of Nrf2 enhances purine biosynthesis by upregulating the pentose phosphate pathway and the metabolism of folate and glutamine, particularly in rapidly proliferating cells (Fig. 2) [24]. Analysis of the transcriptome of mutant Drosophila deficient for the mitochondrial serine/threonine protein kinase PTEN-induced putative kinase 1 (PINK1) has shown that mitochondrial dysfunction leads to the transcriptional upregulation of genes affecting nucleotide metabolism [96], suggesting that the enhanced nucleotide biosynthesis represents a mechanism for protection against the neurotoxic consequences of PINK1 deficiency. Nrf2 regulates the expression of phosphoribosyl pyrophosphate amidotransferase (PPAT), which catalyzes the entry into the de novo purine nucleotide biosynthetic pathway, and mitochondrial methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) (Fig. 2). The latter is a bifunctional enzyme with dehydrogenase and cyclohydrolase activities that is critical in providing both glycine and formate as sources of one-carbon units for purine biosynthesis in rapidly growing cells [97]. It is therefore likely that Nrf2 activation might be protective and might reverse mitochondrial dysfunction in PINK1 deficiency. Indeed, pharmacological activation of Nrf2 by sulforaphane, or the triterpenoid RTA-408, restores ??m and protects PINK1-deficient cells against dopamine toxicity [98]. Although the underlying mechanisms seem to be complex, together, these findings indicate that Nrf2 activity may affect mitochondrial biogenesis by influencing the expression levels of critical transcription factors and coactivators, as well as by enhancing nucleotide biosynthesis.

Nrf2 and Mitochondrial Integrity

Although direct evidence is not always available, there are strong indications that Nrf2 is important for mitochondrial integrity, particularly under conditions of oxidative stress. Mitochondria isolated from the brain and liver of rats that had been administered a single dose of the Nrf2 activator sulforaphane are resistant to opening of the mitochondrial permeability transition pore (mPTP) caused by the oxidant tert-butylhydroperoxide [99], [100]. The mPTP, a complex that allows the mitochondrial inner membrane to become permeable to molecules with masses up to 1500 Da, was recently identified to be formed from dimers of the F0F1-ATP synthase [101]. The sulforaphane-mediated resistance to mPTP opening correlates with increased antioxidant defenses, and the levels of mitochondrial GSH, glutathione peroxidase 1, malic enzyme 3, and thioredoxin 2 are all upregulated in mitochondrial fractions isolated from sulforaphane-treated animals [100].

Mitochondrial protein damage and impairment in respiration caused by the electrophilic lipid peroxidation product 4-hydroxy-2-nonenal are attenuated in mitochondria isolated from the cerebral cortex of sulforaphane-treated mice [102]. In rat renal epithelial cells and in kidney, sulforaphane is protective against cisplatin- and gentamicin-induced toxicity and loss of ??m[103], [104]. Protection against a panel of oxidants (superoxide, hydrogen peroxide, peroxynitrite) and electrophiles (4-hydroxy-2-nonenal and acrolein) and an increase in mitochondrial antioxidant defenses have been also observed upon treatment of rat aortic smooth muscle cells with sulforaphane [105]. In a model of contrast-induced acute kidney injury, limb ischemic preconditioning was recently shown to have protective effects, including inhibition of the opening of the mPTP and mitochondrial swelling, by activation of Nrf2 consequent to the inhibition of GSK3? [106].

Mitophagy, the process by which dysfunctional mitochondria are selectively engulfed by autophagosomes and delivered to lysosomes to be degraded and recycled by the cell, is essential for mitochondrial homeostasis [107], [108]. Whereas no causative relation between Nrf2 and mitophagy has been established, there is evidence that the transcription factor may be important in mitochondrial quality control by playing a role in mitophagy. This might be especially prominent under conditions of oxidative stress. Thus, in a model of sepsis, the increases in the levels of the autophagosome marker MAP1 light chain 3-II (LC3-II) and the cargo protein p62 at 24 h postinfection are suppressed in Nrf2-KO compared to WT mice [109]. A small-molecule inducer of mitophagy (called p62-mediated mitophagy inducer, PMI) was recently discovered; this 1,4-diphenyl-1,2,3-triazole compound was originally designed as an Nrf2 activator that disrupts the interaction of the transcription factor with Keap1 [110]. Similar to cells in which Nrf2 is genetically upregulated (Keap1-KD or Keap1-KO), cells exposed to PMI have higher resting ??m. Importantly, the increase in mitochondrial LC3 localization that is observed after PMI treatment of WT cells does not occur in Nrf2-KO cells, suggesting the involvement of Nrf2.

Last, ultrastructural analysis of liver sections has revealed the presence of swollen mitochondria with reduced crista and disrupted membranes in hepatocytes of Nrf2-KO, but not WT, mice that had been fed a high-fat diet for 24 weeks; notably, these livers show clear evidence of oxidative stress and inflammation [68]. It can be concluded that Nrf2 has a critical role in maintaining mitochondrial integrity under conditions of oxidative and inflammatory stress.

Sulforaphane and Its Effects on Cancer, Mortality, Aging, Brain and Behavior, Heart Disease & More

Isothiocyanates are some of the most important plant compounds you can get in your diet. In this video I make the most comprehensive case for them that has ever been made. Short attention span? Skip to your favorite topic by clicking one of the time points below. Full timeline below.

Key sections:

  • 00:01:14 – Cancer and mortality
  • 00:19:04 – Aging
  • 00:26:30 – Brain and behavior
  • 00:38:06 – Final recap
  • 00:40:27 – Dose

Full timeline:

  • 00:00:34 – Introduction of sulforaphane, a major focus of the video.
  • 00:01:14 – Cruciferous vegetable consumption and reductions in all-cause mortality.
  • 00:02:12 – Prostate cancer risk.
  • 00:02:23 – Bladder cancer risk.
  • 00:02:34 – Lung cancer in smokers risk.
  • 00:02:48 – Breast cancer risk.
  • 00:03:13 – Hypothetical: what if you already have cancer? (interventional)
  • 00:03:35 – Plausible mechanism driving the cancer and mortality associative data.
  • 00:04:38 – Sulforaphane and cancer.
  • 00:05:32 – Animal evidence showing strong effect of broccoli sprout extract on bladder tumor development in rats.
  • 00:06:06 – Effect of direct supplementation of sulforaphane in prostate cancer patients.
  • 00:07:09 – Bioaccumulation of isothiocyanate metabolites in actual breast tissue.
  • 00:08:32 – Inhibition of breast cancer stem cells.
  • 00:08:53 – History lesson: brassicas were established as having health properties even in ancient Rome.
  • 00:09:16 – Sulforaphane’s ability to enhance carcinogen excretion (benzene, acrolein).
  • 00:09:51 – NRF2 as a genetic switch via antioxidant response elements.
  • 00:10:10 – How NRF2 activation enhances carcinogen excretion via glutathione-S-conjugates.
  • 00:10:34 – Brussels sprouts increase glutathione-S-transferase and reduce DNA damage.
  • 00:11:20 – Broccoli sprout drink increases benzene excretion by 61%.
  • 00:13:31 – Broccoli sprout homogenate increases antioxidant enzymes in the upper airway.
  • 00:15:45 – Cruciferous vegetable consumption and heart disease mortality.
  • 00:16:55 – Broccoli sprout powder improves blood lipids and overall heart disease risk in type 2 diabetics.
  • 00:19:04 – Beginning of aging section.
  • 00:19:21 – Sulforaphane-enriched diet enhances lifespan of beetles from 15 to 30% (in certain conditions).
  • 00:20:34 – Importance of low inflammation for longevity.
  • 00:22:05 – Cruciferous vegetables and broccoli sprout powder seem to reduce a wide variety of inflammatory markers in humans.
  • 00:23:40 – Mid-video recap: cancer, aging sections
  • 00:24:14 – Mouse studies suggest sulforaphane might improve adaptive immune function in old age.
  • 00:25:18 – Sulforaphane improved hair growth in a mouse model of balding. Picture at 00:26:10.
  • 00:26:30 – Beginning of brain and behavior section.
  • 00:27:18 – Effect of broccoli sprout extract on autism.
  • 00:27:48 – Effect of glucoraphanin on schizophrenia.
  • 00:28:17 – Start of depression discussion (plausible mechanism and studies).
  • 00:31:21 – Mouse study using 10 different models of stress-induced depression show sulforaphane similarly effective as fluoxetine (prozac).
  • 00:32:00 – Study shows direct ingestion of glucoraphanin in mice is similarly effective at preventing depression from social defeat stress model.
  • 00:33:01 – Beginning of neurodegeneration section.
  • 00:33:30 – Sulforaphane and Alzheimer’s disease.
  • 00:33:44 – Sulforaphane and Parkinson’s disease.
  • 00:33:51 – Sulforaphane and Hungtington’s disease.
  • 00:34:13 – Sulforaphane increases heat shock proteins.
  • 00:34:43 – Beginning of traumatic brain injury section.
  • 00:35:01 – Sulforaphane injected immediately after TBI improves memory (mouse study).
  • 00:35:55 – Sulforaphane and neuronal plasticity.
  • 00:36:32 – Sulforaphane improves learning in model of type II diabetes in mice.
  • 00:37:19 – Sulforaphane and duchenne muscular dystrophy.
  • 00:37:44 – Myostatin inhibition in muscle satellite cells (in vitro).
  • 00:38:06 – Late-video recap: mortality and cancer, DNA damage, oxidative stress and inflammation, benzene excretion, cardiovascular disease, type II diabetes, effects on the brain (depression, autism, schizophrenia, neurodegeneration), NRF2 pathway.
  • 00:40:27 – Thoughts on figuring out a dose of broccoli sprouts or sulforaphane.
  • 00:41:01 – Anecdotes on sprouting at home.
  • 00:43:14 – On cooking temperatures and sulforaphane activity.
  • 00:43:45 – Gut bacteria conversion of sulforaphane from glucoraphanin.
  • 00:44:24 – Supplements work better when combined with active myrosinase from vegetables.
  • 00:44:56 – Cooking techniques and cruciferous vegetables.
  • 00:46:06 – Isothiocyanates as goitrogens.
Dr Jimenez White Coat
Nrf2 is a transcription factor which plays an important role in the cellular antioxidant defense system of the human body. The antioxidant responsive element, or ARE, is a regulatory mechanism of genes. Many research studies have demonstrated that Nrf2, or NF-E2-related factor 2, regulates a wide variety of ARE-driven genes throughout several types of cells. Nrf2 was also found to play an essential role in cellular protection and anti-carcinogenicity, which demonstrates that Nrf2 may be an effective treatment in the management of neurodegenerative diseases and cancers believed to be caused by oxidative stress. Dr. Alex Jimenez D.C., C.C.S.T. Insight

Concluding Remarks

Although many questions still remain open, the available experimental evidence clearly indicates that Nrf2 is an important player in the maintenance of mitochondrial homeostasis and structural integrity. This role becomes particularly critical under conditions of oxidative, electrophilic, and inflammatory stress when the ability to upregulate Nrf2-mediated cytoprotective responses influences the overall health and survival of the cell and the organism. The role of Nrf2 in mitochondrial function represents another layer of the broad cytoprotective mechanisms orchestrated by this transcription factor. As many human pathological conditions have oxidative stress, inflammation, and mitochondrial dysfunction as essential components of their pathogenesis, pharmacological activation of Nrf2 holds promise for disease prevention and treatment. Comprehensive understanding of the precise mechanisms by which Nrf2 affects mitochondrial function is essential for rational design of future clinical trials and may offer new biomarkers for monitoring therapeutic efficacy.

Acknowledgments

Sciencedirect.com/science/article/pii/S0891584915002129

The purpose of the article above was to discuss�as well as demonstrate�the emerging role of Nrf2 in mitochondrial function. Nrf2, or nuclear factor erythroid 2-related factor, is an emerging regulator of cellular resistance to oxidants which can contribute to oxidative stress, affecting cellular function and leading to the development of toxicity, chronic disease, and even cancer. While the production of oxidants in the human body can serve�various purposes,�including cell division, inflammation, immune function, autophagy, and stress response, it’s essential to control their overproduction to prevent health issues. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.

Curated by Dr. Alex Jimenez

Referenced from: Sciencedirect.com

Green Call Now Button H .png

Additional Topic Discussion:�Acute Back Pain

Back pain�is one of the most prevalent causes of disability and missed days at work worldwide. Back pain attributes to the second most common reason for doctor office visits, outnumbered only by upper-respiratory infections. Approximately 80 percent of the population will experience back pain at least once throughout their life. The spine is a complex structure made up of bones, joints, ligaments, and muscles, among other soft tissues. Because of this, injuries and/or aggravated conditions, such as�herniated discs, can eventually lead to symptoms of back pain. Sports injuries or automobile accident injuries are often the most frequent cause of back pain, however, sometimes the simplest of movements can have painful results. Fortunately, alternative treatment options, such as chiropractic care, can help ease back pain through the use of spinal adjustments and manual manipulations, ultimately improving pain relief. �

blog picture of cartoon paper boy

EXTRA EXTRA | IMPORTANT TOPIC: Recommended El Paso, TX Chiropractor

***

Nrf2 Signaling Pathway: Pivotal Roles in Inflammation

Nrf2 Signaling Pathway: Pivotal Roles in Inflammation

Nrf2 supports the activation of a group of antioxidant and detoxifying enzymes and genes which protect the human body from the effects of health issues associated with increased levels of oxidative stress, such as Alzheimer’s disease. A variety of natural substances have been demonstrated to activate the Nrf2 pathway, which can help manage the symptoms of neurodegenerative diseases. The purpose of the article below is to discuss the pivotal role of Nrf2 caused by chronic inflammation.

Abstract

Inflammation is the most common feature of many chronic diseases and complications, while playing critical roles in carcinogenesis. Several studies have demonstrated that Nrf2 contributes to the anti-inflammatory process by orchestrating the recruitment of inflammatory cells and regulating gene expression through the antioxidant response element (ARE). The Keap1 (Kelch-like ECH-associated protein)/Nrf2 (NF-E2 p45-related factor 2)/ARE signaling pathway mainly regulates anti-inflammatory gene expression and inhibits the progression of inflammation. Therefore, the identification of new Nrf2-dependent anti-inflammatory phytochemicals has become a key point in drug discovery. In this review, we discuss the members of the Keap1/Nrf2/ARE signal pathway and its downstream genes, the effects of this pathway on animal models of inflammatory diseases, and crosstalk with the NF-?B pathway. In addition we also discuss about the regulation of NLRP3 inflammasome by Nrf2. Besides this, we summarize the current scenario of the development of anti-inflammatory phytochemicals and others that mediate the Nrf2/ARE signaling pathway.

Keywords: Nrf2, Keap1, ARE, Inflammation, Oxidative stress, Phytochemical

Abbreviations

Sciencedirect.com/science/article/pii/S0925443916302861#t0005

Introduction

Inflammation is a complex process that occurs when tissues are infected or injured by harmful stimuli such as pathogens, damage, or irritants. Immune cells, blood vessels, and molecular mediators are involved in this protective response [1]. Inflammation is also a pathological phenomenon associated with a variety of disease states induced mainly by physical, chemical, biological, and psychological factors. The aim of inflammation is to limit and eliminate the causes of cellular damage, clear and/or absorb necrotic cells and tissues, and initiate tissue repair. Two distinct forms of inflammation are distinguished: acute and chronic. Acute inflammation is self-limiting and beneficial to the host, but prolonged chronic inflammation is a common feature of many chronic diseases and complications. Direct infiltration by many mononuclear immune cells such as monocytes, macrophages, lymphocytes, and plasma cells, as well as the production of inflammatory cytokines, lead to chronic inflammation. It is recognized that chronic inflammation plays a critical role in carcinogenesis [2]. In general, both pro- and anti-inflammatory signaling pathways interact in the normal inflammatory process.

In the pathological inflammatory process, mast cells, monocytes, macrophages, lymphocytes, and other immune cells are first activated. Then the cells are recruited to the site of injury, resulting in the generation of reactive oxygen species (ROS) that damage macromolecules including DNA. At the same time, these inflammatory cells also produce large amounts of inflammatory mediators such as cytokines, chemokines, and prostaglandins. These mediators further recruit macrophages to localized sites of inflammation and directly activate multiple signal transduction cascades and transcription factors associated with inflammation. The NF-?B (nuclear factor kappa B), MAPK (mitogen-activated protein kinase), and JAK (janus kinase)-STAT (signal transducers and activators of transcription) signaling pathways are involved in the development of the classical pathway of inflammation [3], [4], [5]. Previous studies have revealed that the transcription factor Nrf2 (NF-E2 p45-related factor 2) regulates the expression of phase II detoxifying enzymes including NADPH, NAD(P)H quinone oxidoreductase 1, glutathione peroxidase, ferritin, heme oxygenase-1 (HO-1), and antioxidant genes that protect cells from various injuries via their anti-inflammatory effects, thus influencing the course of disease [6], [7], [8].

Considering these remarkable findings, the development of targeted therapeutic drugs for inflammatory diseases via signaling pathways has attracted much interest in recent years. In this review, we summarize research on the Keap1 (Kelch-like ECH associated protein)/Nrf2 (NF-E2 p45-related factor 2)/ARE (antioxidant response element) signaling pathway in inflammation.

Structure and Regulation of Nrf2

Keap1-Dependent Nrf2 Regulation

Nrf2 belongs to the Cap �n� Collar (CNC) subfamily and comprises in seven functional domains, Neh (Nrf2-ECH homology) 1 to Neh7 [9], [10]. Neh1 is a CNC-bZIP domain that allows Nrf2 to heterodimerize with small musculoaponeurotic fibrosarcoma (Maf) protein, DNA, and other transcription partners as well as forming a nuclear complex with the ubiquitin-conjugating enzyme UbcM2 [11], [12]. Neh2 contains two important motifs known as DLG and ETGE, which are essential for the interaction between Nrf2 and its negative regulator Keap1 [13], [14].

Keap1 is a substrate adaptor for cullin-based E3 ubiquitin ligase, which inhibits the transcriptional activity of Nrf2 via ubiquitination and proteasomal degradation under normal conditions [15], [16], [17]. The KELCH domains of the Keap1 homodimer bind with the DLG and ETGE motifs of the Nrf2-Neh2 domain in the cytosol, where ETGE acts as a hinge with higher affinity and DLG acts as a latch [18]. Under oxidative stress or upon exposure to Nrf2 activators, Nrf2 dissociates from Keap1 binding due to the thiol modification of Keap1 cysteine residues which ultimately prevents Nrf2 ubiquitination and proteasomal degradation [19]. Then Nrf2 translocates into the nucleus, heterodimerizes with small Maf proteins, and transactivates an ARE battery of genes (Fig. 1A). The carboxy-terminal of Neh3 acts as a transactivation domain by interacting with the transcription co-activator known as CHD6 (chromo-ATPase/helicase DNA binding protein) [20]. Neh4 and Neh5 also act as transactivation domains, but bind to another transcriptional co-activator known as CBP (cAMP-response-element-binding protein-binding protein) [21]. Moreover, Neh4 and Neh5 interact with the nuclear cofactor RAC3/AIB1/SRC-3, leading to enhanced Nrf2-targeted ARE gene expression [22]. Neh5 has a redox-sensitive nuclear-export signal which is crucial for the regulation and cellular localization of Nrf2 [23].

Figure 1 Keap1-dependent and -independent regulation of Nrf2. (A) Under basal conditions, Nrf2 is sequestered with Keap1 by its two motifs (ETGE and DLG) that leads to CUL3-mediated ubiquitination followed by proteasome degradation. Under oxidative stress, Nrf2 dissociates from Keap1, translocates to the nucleus and activates the ARE-gene battery. (B) GSK3 phosphorylates Nrf2 and this facilitates the recognition of Nrf2 by ?-TrCP for CUL1-mediated ubiquitination and subsequent proteasome degradation. (C) p62 is sequestered with Keap1, leading to its autophagic degradation, the liberation of Nrf2, and increased Nrf2 signaling.

Keap1-Independent Nrf2 Regulation

Emerging evidence has revealed a novel mechanism of Nrf2 regulation that is independent of Keap1. The serine-rich Neh6 domain of Nrf2 plays a crucial role in this regulation by binding with its two motifs (DSGIS and DSAPGS) to ?-transducin repeat-containing protein (?-TrCP) [24]. ?-TrCP is a substrate receptor for the Skp1�Cul1�Rbx1/Roc1 ubiquitin ligase complex that targets Nrf2 for ubiquitination and proteasomal degradation. Glycogen synthase kinase-3 is a crucial protein involved in Keap1-independent Nrf2 stabilization and regulation; it phosphorylates Nrf2 in the Neh6 domain to facilitate the recognition of Nrf2 by ?-TrCP and subsequent protein degradation [25] (Fig. 1B).

Other Nrf2 Regulators

Another line of evidence has revealed a non-canonical pathway of p62-dependent Nrf2 activation in which p62 sequesters Keap1 to autophagic degradation that ultimately leads to the stabilization of Nrf2 and the transactivation of Nrf2-dependent genes [26], [27], [28], [29] (Fig. 1C).

Accumulating evidence suggests that several miRNAs play an important role in the regulation the Nrf2 activity [30]. Sangokoya et al. [31] demonstrated that miR-144 directly downregulates Nrf2 activity in the lymphoblast K562 cell line, primary human erythroid progenitor cells, and sickle-cell disease reticulocytes. Another interesting study in human breast epithelial cells demonstrated that miR-28 inhibits Nrf2 through a Keap1-independent mechanism [32]. Similarly, miRNAs such as miR-153, miR-27a, miR-142-5p, and miR144 downregulate Nrf2 expression in the neuronal SH-SY5Y cell line [33]. Singh et al. [34] demonstrated that the ectopic expression of miR-93 decreases the expression of Nrf2-regulated genes in a 17?-estradiol (E2)-induced rat model of mammary carcinogenesis.

A recent discovery from our lab identified an endogenous inhibitor of Nrf2 known as retinoic X receptor alpha (RXR?). RXR? is a nuclear receptor, interacts with the Neh7 domain of Nrf2 (amino-acid residues 209�316) via its DNA-binding domain (DBD), and specifically inhibits Nrf2 activity in the nucleus. Moreover, other nuclear receptors such as peroxisome proliferator-activated receptor-?, ER?, estrogen-related receptor-?, and glucocorticoid receptors have also been reported to be endogenous inhibitors of Nrf2 activity [9], [10].

Anti-Inflammatory Role of Nrf2/HO-1 Axis

HO-1 is the inducible isoform and rate-limiting enzyme that catalyzes the degradation of heme into carbon monoxide (CO) and free iron, and biliverdin to bilirubin. Enzymatic degradation of pro-inflammatory free heme as well as the production of anti-inflammatory compounds such as CO and bilirubin play major roles in maintaining the protective effects of HO-1 (Fig. 2).

Figure 2 Overview of the Nrf2/HO-1 pathway. Under basal conditions, Nrf2 binds to its repressor Keap1 which leads to ubiquitination followed by proteasome degradation. During oxidative stress, free Nrf2 translocates to the nucleus, where it dimerizes with members of the small Maf family and binds to ARE genes such as HO-1. Upregulated HO-1 catalyzes the heme into CO, bilirubin, and free iron. CO acts as an inhibitor of the NF-?B pathway which leads to the decreased expression of pro-inflammatory cytokines, while bilirubin also acts as antioxidant. Furthermore, HO-1 directly inhibits the proinflammatory cytokines as well as activating the anti-inflammatory cytokines, thus leads to balancing of the inflammatory process.

Nrf2 induces the HO-1 gene by increasing mRNA and protein expression and it is one of the classic Nrf2 regulated gene which is widely used in numerous in vitro and in vivo studies. Several studies have demonstrated that HO-1 and its metabolites have significant anti-inflammatory effects mediated by Nrf2. Elevation of HO-1 expression which is mediated by activated Nrf2 leads to the inhibition of NF?B signaling results in the reduced intestinal mucosal injury and tight-junction dysfunction in male Sprague-Dawley rat liver transplantation model [35]. Upregulation of Nrf2-dependent HO-1 expression may protect mouse derived C2C12 myoblasts from H2O2 cytotoxicity [36]. Nrf2-dependent HO-1 has an impact on lipopolysaccharide (LPS)-mediated inflammatory responses in RAW264.7- or mouse peritoneal macrophage-derived foam cell macrophages. Nrf2 activity desensitized foam cell macrophages phenotype and prevent immoderate inflammation of macrophages, those play important role in progression of atherosclerosis [37]. The Nrf2/HO-1 axis affects LPS induced mouse BV2 microglial cells and mouse hippocampal HT22 cells, with impact on neuroinflammation. Upregulation of HO-1 expression via Nrf2 pathway in mouse BV2 microglial cells which defend cell death of mouse hippocampal HT22 cells [38]. Furthermore, cobalt-based hybrid molecules (HYCOs) that combine an Nrf2 inducer with a releaser of carbon monoxide (CO) increases Nrf2/HO-1 expression, liberate CO and exert anti-inflammatory activity in vitro. HYCOs also up-regulate tissue HO-1 and deliver CO in blood after administration in vivo, supporting their potential use against inflammatory conditions [39]. Nrf2/HO-1 upregulation reduces inflammation by increasing the efferocytic activity of murine macrophages treated with taurine chloramines [40]. Altogether, the above-explained experimental models revealed that Nrf2/HO-1 axis plays a major role in anti-inflammatory function, suggesting that Nrf2 is a therapeutic target in inflammation-associated diseases.

In addition, the byproducts of HO-1 such as CO, bilirubin, acts as a powerful antioxidant during oxidative stress and cell damage [41], [42]; it suppresses autoimmune encephalomyelitis and hepatitis [43], [44]; and it protects mice and rats against endotoxic shock by preventing the generation of iNOS and NO [45], [46], [47]. Moreover, Bilirubin reduces endothelial activation and dysfunction [48]. Interestingly, bilirubin reduces the transmigration of endothelial leukocytes via adhesion molecule-1 [49]. These specific references indicating not only HO-1 acts as a potent anti-inflammatory agent but also its metabolites.

Inflammatory Mediators and Enzymes Inhibited by Nrf2

Cytokines and Chemokines

Cytokines are low molecular-weight proteins and polypeptides secreted by a variety of cells; they regulate cell growth, differentiation, and immune function, and are involved in inflammation and wound-healing. Cytokines include interleukins (ILs), interferons, tumor necrosis factor (TNF), colony-stimulating factor, chemokines, and growth factors. Some cytokines are counted as pro-inflammatory mediators whereas others have anti-inflammatory functions. Exposure to oxidative stress results in the overproduction of cytokines which causes oxidative stress in target cells. Several pro-inflammatory cytokines are overproduced when NF-?B is activated by oxidative stress. Furthermore, pro-inflammatory oxidative stress causes further activation of NF-?B and the overproduction of cytokines. Activation of the Nrf2/ARE system plays an important role in disrupting this cycle. Chemokines are a family of small cytokines, the major role of which is to guide the migration of inflammatory cells. They function mainly as chemoattractants for leukocytes, monocytes, neutrophils, and others effector cells.

It has been reported that activation of Nrf2 prevents LPS-induced transcriptional upregulation of pro-inflammatory cytokines, including IL-6 and IL-1? [50]. IL-1? and IL-6 production is also increased in Nrf2?/? mice with dextran sulfate-induced colitis [51], [52]. Nrf2 inhibits the production of downstream IL-17 and other inflammatory factors Th1 and Th17, and suppresses the disease process in an experimental model of multiple sclerosis, autoimmune encephalitis [53]. The Nrf2-dependent anti-oxidant genes HO-1, NQO-1, Gclc, and Gclm block TNF-?, IL-6, monocyte chemo attractant protein-1 (MCP1), macrophage inflammatory protein-2 (MIP2), and inflammatory mediators. But in the case of Nrf2-knockout mice, the anti-inflammatory effect does not occur [54]. Peritoneal neutrophils from Nrf2-knockout mice treated with LPS have significantly higher levels of cytokines (TNF-? and IL-6) and chemokines (MCP1 and MIP2) than wild-type (WT) cells [54]. In vitro, transferring the Nrf2 gene to human and rabbit aortic smooth muscle cells suppresses the secretion of MCP1 [8], [55], and Nrf2-dependent HO-1 expression suppresses TNF-?-stimulated NF-?B and MCP-1 secretion in human umbilical vein endothelial cells [56]. These findings hint that, in response to inflammatory stimuli, upregulation of Nrf2 signaling inhibits the overproduction of pro-inflammatory cytokines and chemokines as well as limiting the activation of NF-?B.

Cell Adhesion Molecules

Cell adhesion molecules (CAMs) are proteins that bind with cells or with the extracellular matrix. Located on the cell surface, they are involved in cell recognition, cell activation, signal transduction, proliferation, and differentiation. Among the CAMs, ICAM-1 and VCAM-1 are important members of the immunoglobulin superfamily. ICAM-1 is present in low concentrations in leukocyte and endothelial cell membranes. Upon cytokine stimulation, the concentration significantly increases. ICAM-1 can be induced by IL-1 and TNF and is expressed by the vascular endothelium, macrophages, and lymphocytes. It is a ligand for integrin, a receptor found on leukocytes. When the ICAM-1-integrin bridge is activated, leukocytes bind to endothelial cells and then migrate into subendothelial tissues [57]. VCAM-1 mediates the adhesion of lymphocytes, monocytes, eosinophils, and basophils to vascular endothelium and contributes to leukocyte recruitment, which ultimately leads to tissue damage due to oxidative stress. Nrf2 inhibits the promotor activity of VCAM-1 [58]. The Nrf2-regulated downstream gene HO-1 can affect the expression of E-selectin and VCAM-1, adhesion molecules associated with endothelial cells [59]. The pulmonary expression of several CAMs such as CD-14, TREM1, SELE, SELP, and VCAM-1 are significantly higher in Nrf2?/? mice than in Nrf2+/+ mice [60]. Nrf2 in human aortic endothelial cells suppress TNF-?-induced VCAM-1 expression and interfere with TNF-?-induced monocytic U937 cell adhesion [8]. Overexpression of Nrf2 also inhibits TNF-?-induced VCAM-1 gene expression in human microvascular endothelial cells [61]. The naturally occurring antioxidant 3-hydroxyanthranilic acid (HA), one of l-tryptophan metabolites formed in vivo along the metabolic route known as the kynurenine pathway during inflammation or infection, is found to induce HO-1 expression and to stimulate Nrf2 in human umbilical vein endothelial cells (HUVECs). Nrf2-dependent HO-1 expression induced by HA inhibits MCP-1 secretion, VCAM-1 expression and NF-kB activation associated with vascular injury and inflammation in atherosclerosis [56]. The anti-proliferative and anti-inflammatory synthetic chalcone derivative 2?,4?,6?-tris (methoxymethoxy) chalcone inhibits ICAM-1, the pro-inflammatory cytokine IL-1?, and TNF-? expression in colonic tissue from mice treated with trinitrobenzene sulfonic acid [62]. Upregulation of Nrf2 inhibits the TNF-?-induced ICAM-1 expression in human retinal pigment epithelial cells treated with lycopene [63]. All these studies suggest that Nrf2 plays a key role in the inflammatory process by regulating the migration and infiltration of inflammatory cells to inflamed tissue.

Matrix Metalloproteinases (MMPs)

MMPs are widely present in the extracellular matrix and are involved in physiological and pathological processes such as cell proliferation, migration, differentiation, wound-healing, angiogenesis, apoptosis, and tumor metastasis. It has been reported that the Nrf2/HO-1 axis inhibits MMP-9 in macrophages and MMP-7 in human intestinal epithelial cells, and this is beneficial in the treatment of inflammatory bowel disease [62], [64]. UV irradiation-induced skin damage is more severe in Nrf2-knockout than in WT mice and the MMP-9 level is significantly higher, indicating that Nrf2 reduces MMP-9 expression. Therefore, Nrf2 is considered to be protective against UV irradiation [65]. Another study also reported that the downregulated transcriptional activation of MMP-9 in tumor cell invasion and inflammation is regulated through inhibition of the NF-kB signaling pathway [66]. In traumatic spinal cord injury, the NF-kB signaling pathway also takes part in regulating the mRNA levels of MMP-9 [67]. Therefore, in inflammation the regulation of MMPs is affected directly by the Nrf2 pathway or indirectly through the Nrf2-influenced NF-?B pathway.

Cyclooxygenase-2 (COX2) and Inducible Nitric Oxide Synthase (INOS)

A series of experiments on Nrf2-knockout mice have demonstrated its crucial role in inflammation and the regulation of pro-inflammatory genes such as COX-2 and iNOS. For the first time, Khor et al. reported increased expression of pro-inflammatory cytokines such as COX-2 and iNOS in the colonic tissues of Nrf2?/? mice compared with WT Nrf2+/+ mice, indicating that Nrf2 suppresses their activity [51]. Another report on pretreatment with sulforaphane, one of the well-known Nrf2 activators present in cruciferous vegetables, demonstrated its anti-inflammatory effect of inhibiting the expression of TNF-?, IL-1?, COX-2, and iNOS at both the mRNA and protein levels in primary peritoneal macrophages from Nrf2+/+ mice compared with those from Nrf2?/? mice [68]. Similarly, the hippocampus of Nrf2-knockout mice with LPS-induced inflammation also shows higher expression of inflammation markers such as iNOS, IL-6, and TNF-? than WT mice [69]. Likewise, Nrf2-knockout mice are hypersensitive to the oxidative stress induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine as well as showing increased mRNA and protein levels of inflammation markers such as COX-2, iNOS, IL-6, and TNF-? [70]. Moreover, livers from Nrf2?/? mice challenged with a methionine- and choline-deficient diet have ~ 5-fold higher mRNA expression of Cox2, and iNOS than those from WT mice on the same diet, suggesting an anti-inflammatory role of Nrf2 [71]. Recently, Kim et al. demonstrated that the phytochemical ethyl pyruvate exerts its anti-inflammatory and anti-oxidative effects by decreasing the expression of iNOS through Nrf2 signaling in BV2 cells. They showed that ethyl pyruvate induces the nuclear translocation of Nrf2, which ultimately inhibits the interaction between p65 and p300, leading to decreased expression of iNOS [72]. Furthermore, the carbazole analogue LCY-2-CHO activates Nrf2 and causes its nuclear translocation, leading to the suppression of COX2 and iNOS expression [73] in rat aortic vascular smooth muscle cells.

Paradoxical Role of Nrf2 in the Regulation of NLRP3 iIflammasome�Activity

The NLR family, pyrin domain containing 3 (NLRP3) inflammasome is a multiprotein complex that functions as a pathogen recognition receptor (PRR) and recognizes the wide range of microbial, oxidative stress signals such as pathogen-associated molecular patterns (PAMPs), Damage-associated molecular pattern molecules (DAMPs) and ROS [74]. The activated NLRP3 inflammasome mediates the cleavage of caspase-1 and secretion of pro-inflammatory cytokine interleukin-1? (IL-1?) that ultimately induces the process of cell death known as pyroptosis that protects hosts against a wide range of pathogens [75]. However, aberrant activation of the inflammasome is associated with protein misfolding diseases such as transmissible spongiform encephalopathies, Alzheimer’s disease, Parkinson’s disease and also type 2 diabetes [76], cancer [77], gout, and atherosclerosis [78].

A recent observation from Rong Hu group on association of Nrf2 with negative regulation of inflammasome revealed that, Nrf2 induces the NQO1 expression that leads to the inhibition of NLRP3 inflammasome activation, caspase-1 cleavage and IL-1? generation in macrophages. Furthermore, a well known Nrf2 activator, tert-butylhydroquinone (tBHQ) negatively regulated NLRP3 transcription by activating the ARE by Nrf2-dependent manner [79]. In addition to the above observation, the same group has also been revealed that, dimethyl fumarate (DMF) prevents DSS-induced colitis via activating Nrf2 signaling pathway which is involved in Nrf2 nuclear translocation and inhibition of NLRP3 inflammasome assembly [80].

A series of experiments using natural and synthetic compounds have also revealed the inhibitory effect of Nrf2 on NLRP3 inflammasome activation. For instance, treatment of epigallocatechin-3-gallate (EGCG) in lupus nephritis mice has shown to decreasing renal NLRP3 inflammasome activation which is mediated by Nrf2 signaling pathway [81]. Likewise, citral (3,7-dimethyl-2,6-octadienal), a major active compound in a Chinese herbal medicine Litsea cubeba, inhibits the NLRP3 inflammasome activation via Nrf2 antioxidant signaling pathway in Accelerated and Severe Lupus Nephritis (ASLN) mouse model [82]. Similarly, biochanin protected against LPS/GalN-induced liver injury by activating the Nrf2 pathway and inhibiting NLRP3 inflammasome activation in male BALB/c mice [83]. Furthermore, mangiferin was also shown to up-regulate the expression of Nrf2 and HO-1 in a dose-dependent manner and inhibited LPS/D-GalN-induced hepatic NLRP3, ASC, caspase-1, IL-1? and TNF-? expression [84].

Despite the negative regulation of NLRP3 by Nrf2, it also activates the NLRP3 and AIM2 inflammasome function. Haitao Wen and colleagues discovered that, Nrf2 ?/? mouse macrophages have shown the defective activation of the NLRP3 and AIM2 Inflammasome but not the NLRC4 inflammasome [85]. Interestingly, this observation is depicting the unknown functions of Nrf2 in the context of inflammation associated diseases; hence it is very important to study further to reveal the mechanism in which Nrf2 activates the inflammasome function before considering it as a therapeutic target.

Suppression of Pro-Inflammatory Cytokine Transcription by Nrf2

A very recent investigation based on chromatin immunoprecipitation (ChIP)-seq and ChIP-qPCR results in mouse macrophages revealed that Nrf2 binds to the promoter regions of pro-inflammatory cytokines such as IL-6 and IL-1? and inhibits RNA Pol II recruitment. As a result, RNA Pol II is unable to process the transcriptional activation of IL-6 and IL-1? that ultimately leads to the inhibition of gene expression. For the first time, Masayuki Yamamoto’s group revealed the novel mechanism by which Nrf2 not only transactivates its downstream genes through AREs but also suppresses the transcriptional activation of specific genes with or without an ARE through inhibiting the recruitment of RNA Pol II [50].

Crosstalk Between Nrf2 and NF-?B Pathways

NF-?B is a protein complex responsible for DNA transcription found in almost all types of animal cells and involved in various processes such as inflammation, apoptosis, the immune response, cell growth, and development. p65, a Rel protein of the NF-?B family, has a transactivation domain whereas p50 does not and requires heterodimerization with Rel protein to activate transcription. During oxidative stress, I?B kinase (IKK) is activated and causes the phosphorylation of I?B, resulting in the release and nuclear translocation of NF-?B. NF-?B causes the transcription of pro-inflammatory mediators such as IL-6, TNF-?, iNOS, IL-1, and intracellular adhesion COX-2.

Abnormal regulation of NF-?B has been connected to rheumatoid arthritis, asthma, inflammatory bowel disease, and Helicobacter pylori infection-induced gastritis [86]. It is currently considered that NF-kB activity influences the Keapl/Nrf2/ARE signaling pathway mainly in three aspects: first, Keap1 degrades IKK? through ubiquitination, thus inhibiting the activity of NF-?B [87]. Second, the inflammatory process induces inflammatory mediators like COX2 derived from the cyclopentenone prostaglandin 15d-PGJ2, a strong electrophile that reacts with Keap1 and activates Nrf2, thus initiating gene transcription with simultaneous inhibition of NF-kB activity [58], [88] (Fig. 3 A, B). Third, NF-?B can combine with the competitive Nrf2 transcriptional co-activator CBP [89], [90] (Fig. 3 C, D).

Figure 3 Crosstalk between the Nrf2 and NF-?B pathways. (A) Keap1 directs the IKK to CUL3-mediated ubiquitination and proteasome degradation which ultimately leads to the inhibition of NF-?B phosphorylation and this mechanism also works as competitive binding of Nrf2 and IKK with Keap1. (B) Oxidative stress activates IKK which phosphorylates NF-?B, leading to its translocation into the nucleus and activation of proinflammatory cytokines such as COX-2. The terminal product of COX-2 known as 15d-PGJ2 acts as an inducer of Nrf2 that ultimately leads to the suppression of oxidative stress. (C) Nrf2 binds with its transcriptional cofactor CBP along with small Maf and other transcriptional machinery to initiate ARE-driven gene expression. (D) When NF-?B binds with CBP in a competitive manner, it inhibits the binding of CBP with Nrf2, which leads to the inhibition of Nrf2 transactivation.

It is assumed that the Nrf2 and NF-?B signaling pathways interact to control the transcription or function of downstream target proteins. In justification of this assumption many examples show that direct or indirect activation and inhibition occur between members of the Nrf2 and NF-?B pathways (Fig. 4). In response to LPS, Nrf2 knockdown significantly increases the NF-?B transcriptional activity and NF-?B-dependent gene transcription, showing that Nrf2 impedes NF-?B activity [60], [91]. In addition, increased expression of Nrf2-dependent downstream HO-1 inhibits NF-?B activity. When prostate cancer cells are briefly exposed to ?-tochopheryl succinate, a derivative of vitamin E, HO-1 expression is upregulated. The end-products of HO-1 inhibit the nuclear translocation of NF-?B [92]. These in vivo studies suggest that Nrf2 negatively regulates the NF-kB signaling pathway. LPS stimulates NF-?B DNA binding activity and the level of the p65 subunit of NF-?B is significantly higher in nuclear extracts from the lungs of Nrf2?/? than from WT mice, suggesting a negative role of Nrf2 in NF-?B activation. Moreover, Nrf2?/? mouse embryo fibroblasts treated with LPS and TNF-? show more prominent NF-?B activation caused by IKK activation and I?B-? degradation [60]. And respiratory syncytial virus clearance is significantly decreased while NF-?B DNA-binding activity is increased in Nrf2?/? mice compared with WT mice [93]. Pristane-induced lupus nephritis in Nrf2?/? mice co-treated with sulforaphane have severe renal damage and pathological alterations as well as elevated iNOS expression and NF-?B activation compared to the WT, suggesting that Nrf2 improves lupus nephritis by inhibiting the NF-?B signaling pathway and clearing ROS [94]. NF-?B activity also occurs when cells are treated with an Nrf2 inducer together with LPS and TNF-?. For example, a synthetic chalcone derivative inhibits TNF-?-induced NF-?B activation both directly and indirectly and partly through the induction of HO-1 expression in human intestinal epithelial HT-29 cells [62]. Suppression of NF-?B translocation and DNA-binding activity as well as the suppression of iNOS expression in hepatocytes are found when F344 rats are treated with 3H-1,2-dithiole-3-thione (D3T) [95]. After co-treatment with sulforaphane and LPS, the LPS-induced expression of iNOS, COX-2, and TNF-? in Raw 264.7 macrophages is downregulated, suggested that sulforaphane has anti-inflammatory activity via inhibition of NF-?B DNA binding [96]. Though several experimental studies have been done to explain the link between the Nrf2 and NF-?B pathways, conflicting results remain. Both positive and negative regulations have been reported between Nrf2 and NF-kB [97]. Usually, chemopreventive electrophiles 3H-1,2-dithiole-3-thione, sulforaphane and Triterpenoid CDDO-Me activate Nrf2 by inhibiting NF-kB and its downregulated genes [98], [99], [100]. In contrast, several agents or conditions such as ROS, LPS, flow shear stress, oxidized LDL, and cigarette smoke have been shown to increase both Nrf2 and NF-kB activity [97]. In addition, in vivo studies have revealed that NF-kB activity is decreased in livers isolated from Nrf2?/? mice and NF-?B binding activity is lower in Nrf2?/? than in Nrf2+/+ mice [101]. However, human aortic endothelial cells treated with adenoviral vector Nrf2 inhibit NF-?B downstream genes without affecting the activity of NF-?B [8]. Therefore, crosstalk between the Nrf2 and NF-?B pathways needs further investigation.

Figure 4 Regulatory loop of Nrf2 and NF-?B. The Nrf2 pathway inhibits NF-?B activation by preventing the degradation of I?B-? and increasing HO-1 expression and antioxidant defenses which neutralize ROS and detoxifying chemicals. As a result, ROS-associated NF-?B activation is suppressed. Likewise, NF-?B-mediated transcription reduces Nrf2 activation by reducing�ARE�gene transcription and free CREB binding protein by competing with Nrf2 for CBP. Moreover, NF-?B increases the recruitment of histone deacetylase (HDAC3) to the ARE region and hence Nrf2 transcriptional activation is prevented.
Dr Jimenez White Coat
The activation of the Nrf2 signaling pathway plays a major role in the expression of enzymes and genes involved in the detoxification of reactive oxidants by enhancing the antioxidant capacity of the cells in the human body. While many research studies are available today, the regulatory mechanisms in Nrf2 activation are not fully understood. A possible role of the Nrf2 signaling pathway in the treatment of inflammation has also been found. Dr. Alex Jimenez D.C., C.C.S.T. Insight

Role of Nrf2 in Inflammatory Diseases

In vivo studies have shown that Nrf2 plays an important role in inflammatory diseases affecting different systems; these include gastritis, colitis, arthritis, pneumonia, liver damage, cardiovascular disease, neurodegenerative disease, and brain damage. In these studies, Nrf2?/? animals showed more severe symptoms of inflammation and tissue damage than WT animals. Therefore, it is believed that the Nrf2 signaling pathway has a protective effect in inflammatory diseases. Intra-tracheal installation of porcine pancreatic elastase induces chronic obstructive pulmonary disease, particularly emphysema. Nrf2-deficient mice are highly susceptible to emphysema, and decreased expression of HO-1, PrxI, and the antiprotease gene SLPI occur in alveolar macrophages. Nrf2 is considered to be a key regulator in the macrophage mediated defense system against lung injury [102]. Nrf2-deficient mice with emphysema induced by tobacco smoke exposure for 6 months show increased bronchoalveolar inflammation, upregulated expression of oxidative stress markers in alveoli, and increased alveolar septal cell apoptosis, suggesting that Nrf2 acts against tobacco-induced emphysema through the increased expression of antioxidant genes [102], [103]. With Nrf2 disruption, allergen-mediated airway inflammation and asthma using ovalbumin complex show increased airway inflammation, airway hyper-reactivity, hyperplasia of goblet cells, and high levels of Th2 in bronchoalveolar lavage and splenocytes, whereas the Nrf2-mediated signaling pathway limits airway eosinophilia, mucus hypersecretion, and airway hyper-reactivity as well as inducing many antioxidant genes that prevent the development of asthma [104]. Carrageenan injection into the pleural cavity induces pleurisy, and 15d-PGJ2 accumulation in Nrf2 inflammatory cells is confined to mouse peritoneal macrophages. During the early phase of inflammation, 15d-PGJ2 activates Nrf2 and regulates the inflammatory process via the induction of HO-1 and PrxI. A study also suggested that COX-2 has an anti-inflammatory effect in the early phase by the production of 15d-PGJ2 [105]. Oral administration of 1% dextran sulfate sodium for 1 week induces colitis associated with histological alterations that include shortening of crypts and infiltration of inflammatory cells in colon tissue. To protect intestinal integrity in colitis, Nrf2 could play an important role by regulating pro-inflammatory cytokines and inducing phase II detoxifying enzymes [51]. In an Nrf2-knockout mouse model of LPS-induced pulmonary sepsis, NF-?B activity regulates the influence of inflammatory cytokines such as COX-2, IL-113, IL-6, and TNF? which are essential for initiating and promoting inflammation [60]. Nrf2 reduces inflammatory damage by regulating these inflammatory factors. In these models of acute inflammation, the increased regulation of antioxidant enzymes, pro-inflammatory cytokines, and mediators by the Nrf2 signaling pathway reduces the inflammatory injury in WT animals. Interestingly, this has also been reported in Nrf2-knockout mice in which the symptoms are markedly exacerbated compared with WT mice. Nrf2-related inflammatory diseases are summarized (Table 1).

Research on Nrf2-Dependent Anti-Inflammatory Drugs

In summary, we have discussed experiments showing that the Nrf2 signal pathway plays a regulatory role in many areas of inflammation, so Nrf2-dependent anti-inflammatory agents are important for the treatment of inflammatory diseases.

Plants have been extraordinarily rich sources of compounds that activate Nrf2 transcription factor, leading to the up-regulation of cytoprotective genes. Recently, several studies were conducted to investigate the effects of different anti-inflammatory agents, mostly of plant origin. For example, curcumin is the active ingredient of turmeric and is also found in small amounts in ginger; isothiocyanates, specifically phenylisothiocyanates are from broccoli, celery, and other vegetables; and anthocyanins are from berries and grapes [124]. Studies have shown that all these agents are not only good antioxidants but also have potent anti-inflammatory effects via Nrf2 induction [125], [126]. Therefore, the development of new anti-inflammatory Nrf2 activators from plant extract has attracted much interest in medical research.

In recent years, many animal experiments have been conducted to confirm the actions of these compounds. Artesunate is used mainly for severe malaria, cerebral malaria, and rheumatic autoimmune diseases; it is also effective in septic lung injury. Artesunate activates Nrf2 and HO-1 expression, and the latter reduces the inflow of pro-inflammatory cytokines and leukocytes into tissue to prevent inflammation [127]. Isovitexin, extracted from the hulls of Oryza sativa rice, is thought to have anti-inflammatory and antioxidant properties; it plays a protective role against LPS-induced acute lung injury by activating the Nrf2/HO-1 pathway and inhibiting MAPK and NF-?B [128]. Fimasartan, a newly popular angiotensin II receptor blocker acting on the renin-angiotensin system, reduces blood pressure; using fimasartan to treat mice with surgically-induced unilateral ureteral obstruction reduces oxidative stress, inflammation, and fibrosis via upregulating Nrf2 and the antioxidant pathway and inhibiting RAS and MAPKs [129]. Sappanone is widely distributed in Southeast Asia, where it is used as an anti-influenza, anti-allergic, and neuroprotective medication; it activates Nrf2 and inhibits NF-?B and so may be beneficial in the treatment of Nrf2- and/or NF-?B-related diseases [130]. Bixin extracted from the seeds of Bixin orellana is used for infectious and inflammatory diseases in Mexico and South America; it decreases inflammatory mediators, alveolar capillary leakage, and oxidative damage in an Nrf2-dependent manner to alleviate ventilation-induced lung injury and restore normal lung morphology [131]. Other plant compounds, such as epigallocatechin gallate, sulforaphane, resveratrol, lycopene, and green tea extract have therapeutic effects on inflammatory diseases through the Nrf2 signaling pathway [132], [133], [134]. Recently another phytochemical, eriodictyol, which is present in citrus fruit, has been reported to have anti-inflammatory and antioxidant effects on cisplatin-induced kidney injury and sepsis-induced acute lung injury by regulating Nrf2, inhibiting NF-?B, and inhibiting the expression of cytokines in macrophages [135], [136]. However, numerous phytochemicals show great promise for the prevention and treatment of various human diseases, and some have already entered the clinical trials stage (Table 2).

These plant compounds activate the Nrf2 signaling pathway mainly in the form of electrophilic materials that modify the cysteine residues of Keap1, leading to free nuclear Nrf2 binding with the ARE, resulting in activation of transcription of the corresponding gene.

Sulforaphane and Its Effects on Cancer, Mortality, Aging, Brain and Behavior, Heart Disease & More

Isothiocyanates are some of the most important plant compounds you can get in your diet. In this video I make the most comprehensive case for them that has ever been made. Short attention span? Skip to your favorite topic by clicking one of the time points below. Full timeline below.

Key sections:

  • 00:01:14 – Cancer and mortality
  • 00:19:04 – Aging
  • 00:26:30 – Brain and behavior
  • 00:38:06 – Final recap
  • 00:40:27 – Dose

Full timeline:

  • 00:00:34 – Introduction of sulforaphane, a major focus of the video.
  • 00:01:14 – Cruciferous vegetable consumption and reductions in all-cause mortality.
  • 00:02:12 – Prostate cancer risk.
  • 00:02:23 – Bladder cancer risk.
  • 00:02:34 – Lung cancer in smokers risk.
  • 00:02:48 – Breast cancer risk.
  • 00:03:13 – Hypothetical: what if you already have cancer? (interventional)
  • 00:03:35 – Plausible mechanism driving the cancer and mortality associative data.
  • 00:04:38 – Sulforaphane and cancer.
  • 00:05:32 – Animal evidence showing strong effect of broccoli sprout extract on bladder tumor development in rats.
  • 00:06:06 – Effect of direct supplementation of sulforaphane in prostate cancer patients.
  • 00:07:09 – Bioaccumulation of isothiocyanate metabolites in actual breast tissue.
  • 00:08:32 – Inhibition of breast cancer stem cells.
  • 00:08:53 – History lesson: brassicas were established as having health properties even in ancient Rome.
  • 00:09:16 – Sulforaphane’s ability to enhance carcinogen excretion (benzene, acrolein).
  • 00:09:51 – NRF2 as a genetic switch via antioxidant response elements.
  • 00:10:10 – How NRF2 activation enhances carcinogen excretion via glutathione-S-conjugates.
  • 00:10:34 – Brussels sprouts increase glutathione-S-transferase and reduce DNA damage.
  • 00:11:20 – Broccoli sprout drink increases benzene excretion by 61%.
  • 00:13:31 – Broccoli sprout homogenate increases antioxidant enzymes in the upper airway.
  • 00:15:45 – Cruciferous vegetable consumption and heart disease mortality.
  • 00:16:55 – Broccoli sprout powder improves blood lipids and overall heart disease risk in type 2 diabetics.
  • 00:19:04 – Beginning of aging section.
  • 00:19:21 – Sulforaphane-enriched diet enhances lifespan of beetles from 15 to 30% (in certain conditions).
  • 00:20:34 – Importance of low inflammation for longevity.
  • 00:22:05 – Cruciferous vegetables and broccoli sprout powder seem to reduce a wide variety of inflammatory markers in humans.
  • 00:23:40 – Mid-video recap: cancer, aging sections
  • 00:24:14 – Mouse studies suggest sulforaphane might improve adaptive immune function in old age.
  • 00:25:18 – Sulforaphane improved hair growth in a mouse model of balding. Picture at 00:26:10.
  • 00:26:30 – Beginning of brain and behavior section.
  • 00:27:18 – Effect of broccoli sprout extract on autism.
  • 00:27:48 – Effect of glucoraphanin on schizophrenia.
  • 00:28:17 – Start of depression discussion (plausible mechanism and studies).
  • 00:31:21 – Mouse study using 10 different models of stress-induced depression show sulforaphane similarly effective as fluoxetine (prozac).
  • 00:32:00 – Study shows direct ingestion of glucoraphanin in mice is similarly effective at preventing depression from social defeat stress model.
  • 00:33:01 – Beginning of neurodegeneration section.
  • 00:33:30 – Sulforaphane and Alzheimer’s disease.
  • 00:33:44 – Sulforaphane and Parkinson’s disease.
  • 00:33:51 – Sulforaphane and Hungtington’s disease.
  • 00:34:13 – Sulforaphane increases heat shock proteins.
  • 00:34:43 – Beginning of traumatic brain injury section.
  • 00:35:01 – Sulforaphane injected immediately after TBI improves memory (mouse study).
  • 00:35:55 – Sulforaphane and neuronal plasticity.
  • 00:36:32 – Sulforaphane improves learning in model of type II diabetes in mice.
  • 00:37:19 – Sulforaphane and duchenne muscular dystrophy.
  • 00:37:44 – Myostatin inhibition in muscle satellite cells (in vitro).
  • 00:38:06 – Late-video recap: mortality and cancer, DNA damage, oxidative stress and inflammation, benzene excretion, cardiovascular disease, type II diabetes, effects on the brain (depression, autism, schizophrenia, neurodegeneration), NRF2 pathway.
  • 00:40:27 – Thoughts on figuring out a dose of broccoli sprouts or sulforaphane.
  • 00:41:01 – Anecdotes on sprouting at home.
  • 00:43:14 – On cooking temperatures and sulforaphane activity.
  • 00:43:45 – Gut bacteria conversion of sulforaphane from glucoraphanin.
  • 00:44:24 – Supplements work better when combined with active myrosinase from vegetables.
  • 00:44:56 – Cooking techniques and cruciferous vegetables.
  • 00:46:06 – Isothiocyanates as goitrogens.

Conclusions

Currently, much research has focused on the role of the Nrf2/Keap1/ARE signaling pathway in inflammation. Among the enzymes upregulated by Nrf2, HO-1 is one of the representative stress response enzymes. HO-1 has prominent anti-inflammatory and antioxidant properties. In general, the Nrf2 signaling pathway also negatively regulates cytokines, chemokine releasing factors, MMPs, and other inflammatory mediators COX-2 and iNOS production, which directly or indirectly affect the relevant NF-kB and MAPK pathways and other networks that control inflammation. It is suggested that the Nrf2 and NF-?B signaling pathways interact to regulate the transcription or function of downstream target proteins. Suppression or inactivation of NF-?B-mediated transcriptional activity through Nrf2 most probably occurs in the early phase of inflammation, as NF-?B regulates the de novo synthesis of an array of pro-inflammatory mediators. However, there are still some limitations in the research such as whether there are connections between Nrf2 and other signaling pathways such as JAK/STAT, the significance of the current Nrf2 activators derived from natural plant sources in inflammation, and how to improve the biological activity and enhance the targeting of these compounds. These require further experimental validation.

In addition, the Nrf2 signaling pathway can regulate > 600 genes [163], of which > 200 encode cytoprotective proteins [164] that are also associated with inflammation, cancer, neurodegenerative diseases, and other major diseases [165]. Growing evidences suggesting that, Nrf2 signaling pathway is deregulated in many cancers, resulting in aberrant expression Nrf2 dependent gene battery. Moreover, inflammation plays a major role in oxidative stress related diseases especially in cancer. Application of several Nrf2 activators to counteract the inflammation may result in aberrant expression of Nrf2 downstream genes which induces oncogenesis and resistance to chemo and/or radio therapy. Therefore, highly specific activators of Nrf2 may be developed to minimize its pleiotropic effects. Several activators of Nrf2 have shown a significant improvement of the anti-inflammatory functions in oxidative stress related diseases. The best example of Nrf2 activator approved by FDA and widely used for the treatment of inflammatory disease such as Multiple sclerosis (MS) is dimethyl fumarate. Tecfidera� (registered name of dimethyl fumarate by Biogen) used effectively to treat relapsing forms of multiple sclerosis in large number of patients [152]. However, the efficacy of using Nrf2 activators to treat inflammatory diseases requires further validation to avoid the deleterious effects of Nrf2. Therefore, development of therapies for the anti-inflammation activity mediated by Nrf2 could have significant clinical impact. Ongoing studies of the Nrf2 signaling pathway around the world are devoted to developing highly-targeted therapeutic agents to control the symptoms of inflammation, and to prevent and treat cancer as well as neurodegenerative and other major diseases.

Acknowledgments

Sciencedirect.com/science/article/pii/S0925443916302861#t0005

In conclusion, Nrf2 senses the levels of oxidative stress in the human body and ultimately helps promote the regulation of antioxidant and detoxifying enzymes and genes. Because chronic inflammation caused by increased levels of oxidative stress has been associated with neurodegenerative diseases, Nrf2 can play an essential role in the treatment of health issues like Alzheimer’s disease, among others. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.

Curated by Dr. Alex Jimenez

Referenced from: Sciencedirect.com

Green Call Now Button H .png

Additional Topic Discussion: Relieving Knee Pain without Surgery

Knee pain is a well-known symptom which can occur due to a variety of knee injuries and/or conditions, including�sports injuries. The knee is one of the most complex joints in the human body as it is made-up of the intersection of four bones, four ligaments, various tendons, two menisci, and cartilage. According to the American Academy of Family Physicians, the most common causes of knee pain include patellar subluxation, patellar tendinitis or jumper’s knee, and Osgood-Schlatter disease. Although knee pain is most likely to occur in people over 60 years old, knee pain can also occur in children and adolescents. Knee pain can be treated at home following the RICE methods, however, severe knee injuries may require immediate medical attention, including chiropractic care. �

blog picture of cartoon paper boy

EXTRA EXTRA | IMPORTANT TOPIC: Recommended El Paso, TX Chiropractor

***

Understanding Nrf2 and its Impact on Neurodegenerative Diseases

Understanding Nrf2 and its Impact on Neurodegenerative Diseases

Neurodegenerative diseases, such as Alzheimer’s disease and Parkinson’s disease, affect millions of individuals worldwide. A variety of treatment options are available to treat the symptoms of several neurodegenerative diseases although the results are often limited. Research studies have found that oxidative stress caused by both internal and external factors can be a cause for the development of neurodegenerative diseases. The transcription factor, Nrf2, has been determined to function as a major defense mechanism against oxidative stress. The purpose of the article below is to show the effects of Nrf2 on neurodegenerative diseases.

Modulation of Proteostasis by Transcription Factor NRF2

Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2)-like 2). NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.

Keywords: Neurodegenerative diseases, Unfolded protein response, Proteasome, Ubiquitin, Autophagy, Oxidative stress

Abbreviations

Sciencedirect.com/science/article/pii/S2213231716304050

Introduction

Nuclear Factor (erythroid-derived 2)-like 2 (NRF2) is a basic-leucine-zipper protein considered nowadays as a master regulator of cellular homeostasis. It controls the basal and stress-inducible expression of over 250 genes that share in common a cis-acting enhancer termed the antioxidant response element (ARE) [1], [2], [3], [4], [5]. These genes participate in phase I, II and III detoxification reactions, glutathione and peroxiredoxin/thioredoxin metabolism, NADPH production through the pentose phosphate pathway and malic enzyme, fatty acid oxidation, iron metabolism, and proteostasis [6]. Given these wide cytoprotective functions, it is possible that a single pharmacological hit in NRF2 might mitigate the effect of the main culprits of chronic diseases, including oxidative, inflammatory and proteotoxic stress. The role of NRF2 in the modulation of the antioxidant defense and resolution of inflammation have been addressed in numerous studies (reviewed in [7]). Here, we will focus on its role in proteostasis, i.e., the homeostatic control of protein synthesis, folding, trafficking and degradation. Examples will be provided in the context of neurodegenerative diseases.

Loss of Proteostasis Influences NRF2 Activity in Neurodegenerative Diseases

A general hallmark of neurodegenerative diseases is the occurrence of aberrant aggregation of some proteins. Thus, misfolded protein aggregates of ?-synuclein (?-SYN) are found in Parkinson’s disease (PD), ?-amyloid (A?) plaques and hyper-phosphorylated TAU neurofibrillary tangles in Alzheimer’s disease (AD), huntingtin (Htt) in Huntington’s disease (HD), superoxide dismutase 1 (SOD1) and TAR DNA binding protein 43 (TDP-43) in amyotrophic lateral sclerosis (ALS), prion protein (PrP) in spongiform encephalopathies, etc. Protein aggregates can have an impact on several cellular pathways, which in turn may affect NRF2 levels and activity.

Different Layers of Regulation Tightly Control NRF2 Activity

Under physiological conditions, cells exhibit low NRF2 protein levels because of its rapid turnover. In response to different stimuli, NRF2 protein is accumulated, enters the nucleus and increases the transcription of ARE-containing genes. Therefore, management of NRF2 protein levels is a key point that should integrate positive and negative input signals. As we will discuss further, NRF2 is activated by diverse overlapping mechanisms to orchestrate a rapid and efficient response but on the other hand NRF2 could be inhibited, probably in a second phase, in order to switch off its response.

From the classic point of view, activation of NRF2 has been considered as a consequence of the cellular response to oxidant or electrophilic compounds. In this regard, the ubiquitin E3 ligase adaptor Kelch-like ECH-associated protein 1 (KEAP1) plays a crucial role. Molecular details will be further addressed in Section 4.1. In brief, KEAP1 acts as a redox sensor due to critical cysteine residues leading to NRF2 ubiquitination and proteasomal degradation. In addition to this classic modulation, NRF2 is profoundly regulated by signaling events. Indeed, different kinases have been shown to phosphorylate and regulate NRF2. For instance, NRF2 can be phosphorylated by mitogen activated protein kinases (MAPKs), although its contribution to NRF2 activity remains unclear [8], [9], [10], [11]. PKA kinase as well as some PKC isozymes [12], CK2 [13] or Fyn [14] phosphorylate NRF2 modifying its stability. Previous work from our group reported that glycogen synthase kinse-3? (GSK-3?) inhibits NRF2 by nuclear exclusion and proteasomal degradation [15], [25], [26], [27], [28], [29], [30]. The molecular details will be discussed in the Section 4.1. Furthermore, NRF2 is submitted to other types of regulation. For instance, NRF2 acetylation by CBP/p300 increases its activity [17], while it is inhibited by miR153, miR27a, miR142-5p, and miR144 [16], or by methylation of cytosine-guanine (CG) islands within the NRF2 promoter [18].

Impact of Protein Aggregates on NRF2 Regulatory Mechanisms

In this section we will focus in how accumulation of misfolded protein could impact NRF2 activity providing some of the pathways mentioned above as illustrative examples. Firstly, we need to consider that protein accumulation has been tightly linked with oxidative damage. Indeed, misfolded protein accumulation and aggregation induce abnormal production of reactive oxygen species (ROS) from mitochondria and other sources [19]. As mentioned above, ROS will modify redox-sensitive cysteines of KEAP1 leading to the release, stabilization and nuclear localization of NRF2.

Regarding proteinopathies, an example of dysregulated signaling events that may affect NRF2 is provided by the hyperactivation of GSK-3? in AD. GSK-3?, also known as TAU kinase, participates in the phosphorylation of this microtubule-associated protein, resulting in its aggregation, formation of neurofibrillary tangles and interruption of axonal transport (reviewed in [20]). On the other hand, GSK-3? dramatically reduces NRF2 levels and activity as mentioned above. Although not widely accepted, the amyloid cascade proposes that toxic A? oligomers increase GSK-3? activity together with TAU hyper-phosphorylation and neuron death [21], [22]. There are different models to explain how A? favors GSK3-? activity. For instance, A? binds to the insulin receptor and inhibits PI3K and AKT signaling pathways, which are crucial to maintain GSK-3? inactivated by phosphorylation at its N-terminal Ser9 residue [23]. On the other hand, extracellular A? interacts with Frizzled receptors, blocking WNT signaling [24] and again resulting in release of active GSK-3?. In summary, A? accumulation leads to abnormal hyperactivation of GSK-3?, thus impairing an appropriate NRF2 response.

As discussed in the following section, misfolded proteins lead to activation of PERK and MAPKs, which in turn up-regulate NRF2 [31], [8], [9], [10], [11]. Moreover, dysregulated CBP/p300 activity has been reported in several proteinopathies [32] and a global decrease in DNA methylation in AD brains was also shown [33], therefore providing grounds to explore the relevance of these findings in NRF2 regulation.

We and others have observed in necropsies of PD and AD patients an increase in NRF2 protein levels and some of its targets, such as heme oxygenase 1 (HMOX1), NADPH quinone oxidase 1 (NQO1), p62, etc., both by immunoblot and by immunohistochemistry [34], [35], [36], [37], [38], [39]. The up-regulation of NRF2 in these diseases is interpreted as an unsuccessful attempt of the diseased brain to recover homeostatic values. However, another study indicated that NRF2 is predominantly localized in the cytoplasm of AD hippocampal neurons, suggesting reduced NRF2 transcriptional activity in the brain [40]. It is conceivable that the disparity of these observations is related to changes in the factors that control NRF2 along the progressive stages of neurodegeneration.

Three major systems contribute to proteostasis, namely the unfolded protein response (UPR), the ubiquitin proteasome system (UPS) and autophagy. Next, we present evidence to envision NRF2 as a hub connecting emergency signals activated by protein aggregates with the protein derivative machinery.

NRF2 Participates in the Unfolded Protein Response (UPR)

NRF2 Activation in Response to the UPR

Oxidative protein folding in the ER is driven by a number of distinct pathways, the most conserved of which involves the protein disulfide-isomerase (PDI) and the sulfhydryl oxidase endoplasmic oxidoreductin 1 (ERO1? and ERO1? in mammals) as disulfide donor. Briefly, PDI catalyzes the formation and breakage of disulfide bonds between cysteine residues within proteins, as they fold, due to the reduction and oxidation of its own cysteine aminoacids. PDI is recycled by the action of the housekeeping enzyme ERO1, which reintroduces disulfide bonds into PDI [41]. Molecular oxygen is the terminal electron acceptor of ERO1, which generates stoichiometric amounts of hydrogen peroxide for every disulfide bond produced [42]. Peroxidases (PRX4) and glutathione peroxidases (GPX7 and GPX8) are key enzymes to reduce hydrogen peroxide in the ER. When this oxido-reductive system does not work properly, abnormal accumulation of misfolded proteins occurs in the ER and a set of signals named the unfolded protein response (UPR) is transmitted to the cytoplasm and nucleus to reestablish the ER homeostasis [43]. Three membrane-associated proteins have been identified for sensing ER stress in eukaryotes: activating transcription factor 6 (ATF6), pancreatic ER eIF2? kinase (PERK, also double-stranded RNA-activated protein kinase-like ER kinase), and inositol-requiring kinase1 (IRE1). The luminal domain of each sensor is bound to a 78 kDa chaperone termed glucose-regulated protein (GRP78/BIP). BIP dissociates upon ER stress to bind unfolded proteins, leading to the activation of the three sensors [44].

NRF2 and its homologue NRF1, also related to the antioxidant response, participate in the transduction of the UPR to the nucleus. In the case of NRF1, this protein is located at the ER membrane and undergoes nuclear translocation upon deglycosylation or cleavage. Then, UPR activation leads to the processing of NRF1 and nuclear accumulation of the resulting fragment in the nuclear compartment. However, the ability to transactivate ARE-containing genes of this NRF1 fragment is still under discussion [45].

Glover-Cutter and co-workers showed activation of the NRF2 orthologue of C. elegans, SKN-1, with different ER stressors. Increased SKN-1 expression was dependent on different UPR mediators, including IRE1 or PERK worm orthologues [46]. In PERK-deficient cells, impaired protein synthesis leads to accumulation of endogenous peroxides and subsequent apoptosis [47]. The effector used by PERK to protect the ER from these peroxides might be NRF2, since it has been reported that PERK phosphorylates NRF2 at Ser40, thus preventing its degradation by KEAP1 [31]. The induction of ASK1 is also likely to play a role in this route through the TRAF2-mediated kinase action of IRE1 [48]. Although the role of MAPKs in the regulation of NRF2 is still controversial, it was recently suggested that the IRE1-TRAF2-ASK1-JNK pathway might activate NRF2 [49] (Fig. 1). Interestingly, in C. elegans and human cells, new evidence suggests that cysteine sulfenylation of IRE1 kinase at its activation loop inhibits IRE1-mediated UPR and initiates a p38 antioxidant response driven by NRF2. The data suggest that IRE1 has an ancient function as a cytoplasmic sentinel that activates p38 and NRF2 [50].

Figure 1 Regulation of NRF2 by the UPR. Accumulation of unfolded or misfolded proteins inside the endoplasmic reticulum can initiate the unfolded protein response (UPR). First, the chaperone BIP is released from the intraluminal domain of the ER sensors IRE1 and PERK to bind unfolded/misfolded proteins. This enables dimerization and trans-auto-phosphorylation of their cytosolic domains. PERK activation results in direct NRF2 phosphorylation at Ser40, leading to NRF2 translocation to the nucleus and activation of target genes. IRE1 activation induces the recruitment of TRAF2 followed by ASK1 and JNK phosphorylation and activation. As JNK has been reported to phosphorylate and activate NRF2, it is reasonable to think that IRE1 activation would lead to increased NRF2 activity.

Many studies on the induction of the UPR have been conducted with the inhibitor of protein glycosylation tunicamycin. NRF2 appears to be essential for prevention of tunicamycin-induced apoptotic cell death [31] and its activation under these conditions is driven by the autophagic degradation of KEAP1 [51]. Accordingly, shRNA-mediated silencing of NRF2 expression in ?TC-6 cells, a murine insulinoma ?-cell line, significantly increased tunicamycin-induced cytotoxicity and led to an increase in the expression of the pro-apoptotic ER stress marker CHOP10. On the other hand, NRF2 activation by 1,2-dithiole-3-thione (D3T) reduced tunicamycin cytotoxicity and attenuated the expression of CHOP10 and PERK [52]. Interestingly, olfactory neurons submitted to systemic application of tunicamycin increased NRF2 in parallel with other UPR-members such as CHOP, BIP, XBP1 [53]. These results have been extended to in vivo studies, as lateral ventricular infusion of tunicamycin in rats induced expression of PERK and NRF2 in the hippocampus accompanied by significant cognitive deficits, increased TAU phosphorylation and A?42 deposits [54].

NRF2 Up-Regulates Key Genes for the Maintenance of the ER Physiology

The ER lumen needs an abundant supply of GSH from the cytosol in order to maintain disulfide chemistry. NRF2 modulates crucial enzymes of the GSH metabolism in the brain, such as cystine/glutamate transport, ?-glutamate cysteine synthetase (?-GS), glutamate-cysteine ligase catalytic and modulator subunits (GCLC and GCLM), glutathione reductase (GR) and glutathione peroxidase (GPX) (reviewed in [55]). The relevance of NRF2 in the maintenance of GSH in the ER is supported by the finding that pharmacological or genetic activation of NRF2 results in increased GSH synthesis via GCLC/GCLM, while inhibiting the expression of these enzymes by NRF2-knockdown caused an accumulation of damaged proteins within the ER leading to the UPR activation [56].

In C. elegans several components of the UPR target genes regulated by SKN-1, including Ire1, Xbp1 and Atf6. Although NRF2 up-regulates the expression of several peroxidase (PRX) and glutathione peroxidase (GPX) genes in mammals (reviewed in [57]), only GPX8 is a bona fide ER-localized enzyme, harboring the KDEL retrieval signal [58]. Loss of GPX8 causes UPR activation, leakage of ERO1?-derived hydrogen peroxide to the cytosol and cell death. Hydrogen peroxide derived from ERO1? activity cannot diffuse from the ER to the cytosol owing to the concerted action of GPX8 and PRX4 [59]. In this regard, an analysis of the antioxidant defense pathway-gene expression array using RNA from wild type and NRF2-null mice tissue, revealed that the expression of GPX8 was down-regulated in the absence of NRF2 [60]. In line with this, transcriptome analysis from patient samples suffering from myeloproliferative neoplasms, polycythemia or myelofibrosis, diseases also associate with oxidative stress and low-grade chronic inflammation, show lower expression levels of both NRF2 and GPX8 compared with control subjects [61]. There are not yet studies that specifically involve GPX8 in human brain protection but a transcriptome analysis in mice indicates a compensatory GPX8 increase in response to the Parkinsonian toxin MPTP [62].

Impact of NRF2 on the UPR Dysregulation in Neurodegenerative Diseases

Malfunction of PDI enzymes and chronic activation of the UPR might subsequently initiate or accelerate neurodegeneration. Disease-affected neurons, animal models of neurodegenerative disease as well as post-mortem human tissues evidenced up-regulation of several UPR-markers in most of these disorders. The alteration of PDI/UPR pathway in neurodegenerative diseases has been nicely reviewed in [63] but the following highlights from brain post-mortem samples should be considered. PDI levels are increased in tangle-bearing neurons and in Lewy Bodies of AD and PD patients, respectively [64], [65]. PDI and ERP57 are up-regulated in CSF from ALS patients and in brains from CJD subjects [66], [67], [68]. BIP, PERK, IRE1 and ATF6 are elevated in samples from patients with AD, PD or ALS [69], [70], [71], [67]. BIP, CHOP and XBP1 are elevated in post-mortem brain samples from HD [72], [73]. Moreover, up-regulation of ERP57, GRP94 and BIP was found in cortex tissues from CJD patients [74]. Altogether, this evidence reveals that the accumulation of misfolded proteins in the brain parenchyma leads to a deleterious and chronic activation of the UPR. Interestingly, there is a recent study linking activation of NRF2 by PERK in early AD. In this study, the authors analyzed whether oxidative stress mediated changes in NRF2 and the UPR may constitute early events in AD pathogenesis by using human peripheral blood cells and an AD transgenic mouse model at different disease stages. Increased oxidative stress and increased pSer40-NRF2 were observed in human peripheral blood mononuclear cells isolated from individuals with mild cognitive impairment. Moreover, they reported impaired ER calcium homeostasis and up-regulated ER-stress markers in these cells from individuals with mild cognitive impairment and mild AD [75].

Mutual Regulation of NRF2 and the Ubiquitin Proteasome�System (UPS)

The UPS Modulates NRF2 Protein Levels

The UPS participates in the degradation of damaged or misfolded proteins and controls the levels of key regulatory molecules in the cytosol and the nucleus. The central core of this system is a large multisubunit enzyme that contains a proteolytic active complex named 20S. The 20S core proteasome degrades unfolded proteins, but binding to different regulatory protein complexes changes its substrate specificity and activity. For instance, the addition of one or two 19S regulatory subunits to the 20S core constitutes the 26S proteasome and changes its specificity towards native folded proteins [76], [77]. Proteasomal degradation needs covalent binding of ubiquitin. Conjugation of ubiquitin proceeds via a three-step cascade mechanism. First, the ubiquitin-activating enzyme E1 activates ubiquitin in an ATP-requiring reaction. Then, one E2 enzyme (ubiquitin-carrier protein or ubiquitin-conjugating enzyme) transfers the activated ubiquitin from E1 to the substrate that is specifically bound to a member of the ubiquitin-protein ligase family, named E3. Although the exact fate of the ubiquitinated-protein will depend on the nature of the ubiquitin chain, this process generally results in the degradation by the 26S proteasome [78].

The E3-ligase KEAP1 is the best known inhibitor of NRF2. The mechanism of KEAP1 regulation elegantly explains how NRF2 levels adjust to oxidant fluctuations. Under basal conditions, newly synthesized NRF2 is grabbed by the homodimer KEAP1, which binds one NRF2 molecule at two amino acid sequences with low (aspartate, leucine, glycine; DLG) and high (glutamate, threonine, glycine, glutamate; ETGE) affinity. The interaction with KEAP1 aids to present NRF2 to the CULLIN3/RBX1 protein complex, resulting in its ubiquitination and subsequent proteasomal degradation. However, redox modification of KEAP1 impedes presentation of NRF2 to the UPS represented by CULLIN3/RBX1. As a result, newly synthetized NRF2 escapes KEAP1-dependent degradation, accumulates in the nucleus and activates ARE-containing genes [79], [80], [81], [82].

The E3-ligase adaptor ?-TrCP is also a homodimer that participates in the signaling events related to the phosphorylation of NRF2 by GSK-3?. This kinase phosphorylates specific serine residues of NRF2 (aspartate, serine, glycine, isoleucine serine; DSGIS) to create a degradation domain that is then recognized by ?-TrCP and tagged for proteasome degradation by a CULLIN1/RBX1 complex. The identification of the specific amino acids that are phosphorylated by GSK-3? in this degron was conducted by a combination of site-directed mutagenesis of the Neh6 domain, 2D-gel electrophoresis [15], [26] and mass spectroscopy [83]. Consequently, inhibition of GSK-3? by highly selective drugs or siRNAs against GSK-3 isoforms resulted in an increase in NRF2 protein levels. Similar results were found with siRNAs against ?-TrCP isoforms 1 and 2. Stabilization of NRF2 following GSK-3? inhibition occurred in KEAP1-deficient mouse embryo fibroblasts and in an ectopically expressed NRF2 deletion mutant lacking the critical ETGE residues for high-affinity binding to KEAP1, further demonstrating a KEAP1-independent regulation.

In the context of neurodegenerative diseases, we can envision the modulation of NRF2 by the UPS in two different ways. On the one hand, the KEAP1 system would sense redox imbalance derived from misfolded protein accumulation, while GSK-3/?-TrCP axis would act as an active participant in signaling transduction altered by loss of proteostasis (Fig. 2).

Figure 2 The UPS tightly controls NRF2 levels. Under homeostatic conditions, low NRF2 levels are maintained by the action of the E3 ligases adaptors KEAP1 and ?-TrCP. Left, NRF2 binds to the Kelch domains of a KEAP1 homodimer through a low (DLG) and a high (ETGE) affinity motifs. Through its BTB domain, KEAP1 simultaneously binds to a CULLIN3/RBX1 complex, enabling NRF2 ubiquitination and degradation by the 26 S proteasome. Moreover, GSK-3? phosphorylates Ser335 and Ser338 residues of NRF2 to create a degradation domain (DpSGIpSL) that is then recognized by the ubiquitin ligase adaptor ?-TrCP and tagged for proteasome degradation by a CULLIN3/RBX1 complex. Right, Upon exposure to reactive oxygen species or electrophiles critical Cys residues in KEAP1 are modified, rendering KEAP1 unable of interacting efficiently with NRF2 or CULLIN3/RBX1 and then this transcription factor increases its half-life and transcriptional activity towards ARE-genes. Signaling pathways that result in inhibition of GSK-3?, such AKT phosphorylation at Ser9, result in NRF2 impaired degradation by the proteasome, accumulation and induction of target genes.

NRF2 Increases UPS Activity Through the Transcriptional Control of Proteasome Subunits

NRF2 up-regulates the expression of several proteasome subunits, thus protecting the cell from the accumulation of toxic proteins. Twenty proteasome- and ubiquitination-related genes appear to be regulated by NRF2, according to a wide microarray analysis from liver RNA that was set up with the NRF2 inducer D3T [84]. In a posterior study, the same authors evidenced that the expression of most subunits of the 26S proteasome were enhanced up to three-fold in livers from mice treated with D3T. Subunit protein levels and proteasome activity were coordinately increased. However, no induction was seen in mice where the transcription factor NRF2 was disrupted. Promoter activity of the PSMB5 (20S) proteasome subunit increased with either NRF2 overexpression or treatment with activators in mouse embryonic fibroblasts, and AREs were identified in the proximal promoter of PSMB5 [85]. Pharmacological activation of NRF2 resulted in elevated expression levels of representative proteasome subunits (PSMA3, PSMA6, PSMB1 and PSMB5) only in non-senescent human fibroblasts containing functional NRF2 [86]. NRF2 activation during adaptation to oxidative stress results in high expression of the PSMB1 (20S) and PA28? subunits (or S11, proteasome regulator) [87]. Moreover, results from human embryonic stem cells revealed that NRF2 controls the expression of the proteasome maturation protein (POMP), a proteasome chaperone, which in turn modulates the proliferation of self-renewing human embryonic stem cells, three germ layer differentiation and cellular reprogramming [88]. All together, these studies indicate that NRF2 up-regulates the expression of key components of the UPS and therefore actively contributes to the clearance of proteins that otherwise would be toxic.

The NRF2-UPS Axis in Neurodegenerative Diseases

The role of the UPS in neurodegenerative diseases is a field of intensive debate. Initial studies reported decreased proteasome activity in human necropsies of patients affected from several neurodegenerative diseases. However, other studies employing in vitro and in vivo approaches found unchanged or even increased proteasome activity (reviewed in [89]). One possible explanation for this discrepancy is that the levels of the UPS components might change during disease progression and in different brain regions as is has been suggested for NRF2-targets.

Despite this controversy, it should be noted that up-regulation of ARE-containing proteasome genes will reinforce the UPS by increasing the clearance of toxic proteins in the brain. Indeed, ablation of NRF1, also modulator of the antioxidant response, in neuronal cells leads to impaired proteasome activity and neurodegeneration. Chromatin immunoprecipitation experiments and transcriptional analysis demonstrated that PSMB6 is regulated by NRF1. In addition, gene expression profiling led to the identification of NRF1 as a key transcriptional regulator of proteasome genes in neurons, suggesting that perturbations in NRF1 may contribute to the pathogenesis of neurodegenerative diseases [90]. Interestingly, NRF1 and its long isoform called TCF11 were shown to up-regulate ARE-containing proteasome genes upon proteasome inhibition in a feedback loop to compensate for reduced proteolytic activity [91], [92].

Regarding NRF2, there is a correlation among reduction of NRF2, RPT6 (19 S) and PSMB5 (20 S) levels in the midbrain of DJ-1-deficient mice treated with the neurotoxin paraquat [93]. Moreover, the naturally-occurring compound sulforaphane (SFN) gives a more robust image of NRF2 as a crucial modulator of the UPS. In vitro experiments with murine neuroblastoma Neuro2A cells evidenced an enhanced expression of the catalytic subunits of the proteasome, as well as its peptidase activities in response to SFN. This drug protected cells from hydrogen peroxide-mediated cytotoxicity and protein oxidation in a manner dependent on proteasome function [94]. In addition, Liu and co-workers employed a reporter mouse to monitor the UPS activity in response to SFN in the brain. These mice ubiquitously express the green fluorescence protein (GFP) fused to a constitutive degradation signal that promotes its rapid degradation by the UPS (GFPu). In cerebral cortex, SFN reduced the level of GFPu with a parallel increase in chymotrypsin-like (PSMB5), caspase-like (PSMB2), and trypsin-like (PSMB1) activities of the 20 S proteasome. In addition, treatment of Huntington-derived cells with SFN revealed that NRF2 activation enhanced mHtt degradation and reduced mHtt cytotoxicity [95]. The major mechanism of SFN action is through induction of NRF2 [96]. The specific contribution of NRF2 should be addressed employing NRF2-null systems in further studies.

Functional Connection Between NRF2 and Macroautophagy

NRF2 Protein Levels are Modulated by the Adaptor Protein P62

Autophagy refers to the degradation of cytosolic components inside lysosomes. This process is used for the clearance of long-lived and misfolded proteins as well as damaged organelles. A direct link between NRF2 and autophagy was first observed in connection with the adaptor protein p62, also termed SQSTM1 [97], [98], [99], [100], [101]. This protein shuttles ubiquitinated proteins to the proteasomal and lysosomal degradation machineries and sequesters damaged proteins into aggregates prior to their degradation. P62 presents an ubiquitin-associated (UBA) domain, for binding to ubiquitinated proteins, and a LC3-interacting region (LIR) for integration with the autophagosomal membrane through the autophagy receptor LC3.

Although the p62-mediated induction of NRF2 and its target genes was first reported in 2007 [102], the molecular mechanism was not fully understood until the discovery of its interaction with KEAP1 [103], [98], [99], [100], [101]. Komatsu and coworkers identified a KEAP1 interacting region (KIR) in p62 that bound KEAP1 in the same basic surface pocket as NRF2 and with a binding affinity similar to the ETGE motif in NRF2, suggesting competition between p62 and NRF2. The phosphorylation of Ser351 in the KIR motif in p62 (349-DPSTGE-354) was shown to increase its affinity for KEAP1, competing with NRF2 binding and allowing its accumulation and transcriptional activation of its target genes [98], [99]. In fact, p62 overexpression led to reduced NRF2 ubiquitination and consequent stabilization as well as induction of its target genes [104]. Some kinases have been suggested to participate in p62 phosphorylation. The mammalian target of rapamycin complex 1 (mTORC1) may be implicated, as treatment with the mTOR inhibitor rapamycin suppressed the phosphorylation of p62 and the down-regulation of KEAP1 upon arsenite treatment. Recently, it was demonstrated that TGF-?-activated kinase 1 (TAK1) could also phosphorylate p62, enhancing KEAP1 degradation and NRF2-up-regulation. The authors of this study suggest this is a way to regulate cellular redoxtasis under steady-state conditions, as TAK1-deficiency up-regulates ROS in the absence of any exogenous oxidant in different mouse tissues in parallel with a reduction in NRF2 protein levels [105].

A p62 construct lacking the UBA domain was still capable of binding KEAP1, implying that the interaction did not depend on ubiquitinated KEAP1 [101]. However, the p62 homologue in Drosophila melanogaster, named Ref(2), does not contain a KIR motif and does not directly interact with DmKEAP1, although it can bind to ubiquitinated DmKEAP1 through the UBA domain. Moreover, DmKEAP1 can directly interact with Atg8 (homologue to mammalian LC3). KEAP1 deficiency results in Atg8 and autophagy induction dependent on the NRF2 orthologue CncC and independent on TFEB/MITF [106]. The relationship between NRF2 and autophagy seems to be conserved though, highlighting its functional relevance.

The induction of NRF2 by p62 is the result of both the competition to bind KEAP1 and degradation of KEAP1 in the lysosome. Silencing of p62 with siRNA doubled KEAP1 half-life in parallel with a decrease in NRF2 and its target genes [101]. In agreement, ablation of p62 expression evidenced increased levels of KEAP1 compared with wild type mice. Very relevant, the increment in KEAP1 levels was not affected by proteasome inhibitors but was reduced under starvation-inducing autophagy [107]. In fact, KEAP1 is present in mammalian cells in autophagic vesicles decorated with p62 and LC3 [99], [100], [103]. All these data suggest that KEAP1 is a substrate of the macroautophagy machinery, but this issue should be analyzed with more detail because of the existence of some controversial results. KEAP1 protein levels were increased in Atg7-null mice, a key effector of macroautophagy [107], but pharmacological inhibition of macroautophagy with torin1, E64/pepstatin or bafilomycin failed to accumulate KEAP1 [107], [100]. Overall, these results suggest that increased p62 levels sequester KEAP1 into autophagic vacuoles and probably these results in KEAP1 autophagic degradation allowing NRF2 activation (Fig. 3). Two different studies reported that the sulfinic acid reductases SESTRINS play an important role in this context. SESTRIN 2 interacts with p62, KEAP1 and RBX1 and facilitates p62-dependent degradation of KEAP1 and NRF2 activation of target genes [108]. Another study showed that SESTRIN 2 interacted with ULK1 and p62, promoting phosphorylation of p62 at Ser403 which facilitated degradation of cargo proteins including KEAP1 [109].

Figure 3 NRF2 levels are regulated by the adaptor protein p62. The phosphorylation of Ser 351 in the KIR motif of p62 (349-DPSTGE-354) by mTORC1, TAK1 or other kinases results in increased affinity for binding to KEAP1 due to resemblance to the ETGE motif in NRF2. As a consequence, phosphorylated p62 displaces NRF2 and binds KEAP1. The LIR motif in p62 enables interaction with LC3 in the autophagosomal membrane, so that p62-KEAP1 complex is eventually degraded in the lysosome. As a consequence NRF2 is able to accumulate, translocate to the nucleus and increase the transcription of ARE-containing genes, including p62. This regulatory mechanism provides a perdurable NRF2 response, as KEAP1 has to be newly synthesized in order to inhibit NRF2 activity.

Modulation of Macroautophagy Genes by NRF2

NRF2 regulates the expression of relevant genes for macroautophagy as well as it does for the UPR and the UPS. The first evidence came from studies in which p62 expression was shown to be induced upon exposure to electrophiles, ROS and nitric oxide [110], [111], [112]. The mechanism of induction was described some years later with the finding that p62 contains a functional ARE in its gene promoter [99]. In a recent study, several other functional AREs were found and validated following bioinformatics analysis and ChIP assays. Moreover, mouse embryonic fibroblasts and cortical neurons from Nrf2-knockout mice exhibited reduced p62 expression, which could be rescued with an NRF2-expressing lentivirus. Similarly, NRF2 deficiency reduced p62 levels in injured neurons from mice hippocampus [36]. Therefore, it has been suggested that NRF2 activation increases p62 levels, resulting in KEAP1 degradation and favoring further NRF2 stabilization in a positive feedback loop. This non-canonical mechanism of NRF2 induction requires changes in gene expression and might be a relevant response to prolonged cellular stress.

The cargo recognition protein NDP52 was shown to be transcriptionally regulated by NRF2. NDP52 works in a similar way to p62, recognizing ubiquitinated proteins and interacting with LC3 through a LIR domain, so that cargoes are degraded in lysosomes. Five putative AREs were found in Ndp52 promoter DNA sequence. Three of them were identified with different mutant constructs and ChIP assays as indispensable for NRF2-mediated Ndp52 transcription [113]. Of note, Ndp52 mRNA levels were reduced in the hippocampus of Nrf2-knockout mice. One of these sequences was also validated in an independent study as an NRF2-regulated ARE [36].

However, the role of NRF2 in the modulation of autophagy is not limited to the induction of these two cargo-recognition proteins. In order to gain deeper insight in the role of NRF2 in the modulation of additional autophagy-related genes, our group screened the chromatin immunoprecipitation database ENCODE for two proteins, MAFK and BACH1, which bind the NRF2-regulated AREs. Using a script generated from the JASPAR’s consensus ARE sequence, we identified several putative AREs in many autophagy genes. Twelve of these sequences were validated as NRF2 regulated AREs in nine autophagy genes, whose expression was diminished in mouse embryo fibroblasts of Nrf2-knockout mice but could be restored by an NRF2-expressing lentivirus. Our study demonstrated that NRF2 activates the expression of some genes involved in different steps of the autophagic process, including autophagy initiation (ULK1), cargo recognition (p62 and NDP52), autophagosome formation (ATG4D, ATG7 and GABARAPL1), elongation (ATG2B and ATG5), and autolysosome clearance (ATG4D). Consequently, autophagy flux in response to hydrogen peroxide was impaired when NRF2 was absent [36].

Relevance of NRF2-Mediated Macroautophagy Genes Expression in Neurodegenerative Disorders

Defective autophagy has been shown to play an important role in several neurodegenerative diseases [114] and ablation of autophagy leads to neurodegeneration in mice [115], [116]. Atg7-knockout mice revealed that autophagy deficiency results in p62 accumulation in ubiquitin-positive inclusion bodies. KEAP1 was sequestered in these inclusion bodies, leading to NRF2 stabilization and induction of target genes [103]. Importantly, excessive accumulation of p62 together with ubiquitinated proteins has been identified in neurodegenerative diseases, including AD, PD and ALS [117]. In fact, neurons expressing high levels of APP or TAU of AD patients also expressed p62 and nuclear NRF2, suggesting their attempt to degrade intraneuronal aggregates through autophagy [36].

NRF2 deficiency aggravates protein aggregation in the context of AD. In fact, increased levels of phosphorylated and sarkosyl-insoluble TAU are found in Nrf2-knockout mice, although no difference in kinase or phosphatase activities could be detected comparing with the wild-type background [113]. Importantly, NDP52 was demonstrated to co-localize with TAU in murine neurons and direct interaction between phospho-TAU and NDP52 was shown by co-immunoprecipitation experiments both in mice and AD samples, pointing to its role in TAU degradation. Interestingly, silencing of NDP52, p62 or NRF2 in neurons resulted in increased phospho-TAU [113], [118]. Moreover, increased intraneuronal APP aggregates were found in the hippocampus of APP/PS1?E9 mice when NRF2 was absent. This correlated with altered autophagy markers, including increased phospho-mTOR/mTOR and phospho-p70S6k/p70S6k ratios (indicative of autophagy inhibition), augmented levels of pre-cathepsin D and a larger number of multivesicular bodies [119]. In mice co-expressing human APP (V717I) and TAU (P301L), NRF2 deficiency led to increased levels of total and phospho-TAU in the insoluble fraction and increased intraneuronal APP aggregates, together with reduced neuronal levels of p62, NDP52, ULK1, ATG5 and GABARAPL1. Co-localization between the adaptor protein p62 and APP or TAU was reduced in the absence of NRF2 [36]. Overall, these results highlight the importance of NRF2 in neuronal autophagy.

Different Transcription Factors Act Coordinately to Modulate Proteostasis

Under steady state conditions, proteostasis is controlled via protein-protein interactions and post-translational modifications obtaining a rapid response. However, cellular adaptation requires the transcriptional regulation of the UPR, UPS and autophagy genes. Considering that nerve cells are continuously submitted to low-grade toxic insults, including oxidative and proteotoxic stress, a reinforcement of proteostasis induced by transcriptional modulation might help preventing brain degeneration.

In the case of the UPR, the activation of each of the three arms will finally result in the transcriptional induction of certain genes (reviewed in [43]). For instance, an ATF6-derived fragment (ATF6f) binds to ER-stress response elements (ERSE) and induces the expression of several genes, including XBPI, BIP and CHOP. In addition, PERK signaling leads to the activation of the transcription factor ATF4, which controls the expression of multiple UPR-related genes and some others including the NRF2 target genes Hmox1 and p62. Finally, IRE1 activation results in the generation of an active transcription factor, spliced XBP1 (XBP1s), which controls the transcription of genes encoding proteins involved in protein folding.

On the other hand, NRF1 was shown to be necessary for proteasomal gene expression in the brain, as Nrf1-knockout mice exhibited reduced expression of genes encoding various subunits of the 20S core, as well the 19S regulatory complex together with impaired proteasomal function [90]. Both NRF1 and NRF2 bind to ARE sequences in the promoter regions of its target genes, which suggests they have overlapping transcriptional activities, although they differ in their regulatory mechanisms and cellular localization [120].

Transcription factors of the Forkhead box O (FOXO) family control the expression of multiple autophagy-related genes. Similar to what occurs with NRF2, there are multiple layers of regulation of the activity of FOXO members, which can be induced upon nutritional or oxidative stress [121]. Finally, the transcription factor TFEB, considered the master regulator of lysosomal biogenesis, plays a crucial role in regulation of autophagy under nutritional stress conditions. Thus, inhibition of mTORC1 leads to nuclear translocation of TFEB and induction of the expression of autophagy genes [122].

Overall, the existence of different transcriptional regulators of these machineries also suggests crosstalk and partially redundant mechanisms that may assure proteostasis under different circumstances. Accordingly, NRF2 may have a relevant role in tissues that support high levels of oxidative stress. For instance, oxidative stress-induced NRF2 may function under nutrient-rich conditions to transcriptionally up-regulate autophagy, similar to what has been found for TFEB under starvation conditions. Moreover, the brain functions largely under nutrient-rich conditions, posing NRF2 as a relevant mechanism to activate autophagy in neurons.

Promising�Therapeutic Potential for NRF2 in Proteinopathies

In the past few years, a great progress has been made in the knowledge of the regulatory roles of the UPR, UPS and autophagy on NRF2 activity, as well as the reciprocal NRF2-mediated transcription of components of these three systems. Therefore, new therapeutic possibilities may arise based on the exploitation of NRF2 as a crucial regulator of protein clearance in neurodegenerative diseases.

However, a key remaining question is whether it will be useful or deleterious to increase NRF2 levels in brain. Analysis of epidemiological data may provide a partial answer, as it indicates that the NFE2L2 gene is highly polymorphic and some single nucleotide polymorphisms found in its promoter regulatory region may provide a range of �physiological� variability in gene expression at the population level and some haplotypes were associated with decreased risk and/or delayed onset of AD, PD or ALS [123]. Moreover, as discussed by Hayes and colleagues [124], NRF2 effect might have an U-shaped response, meaning that too low NRF2 levels may result in a loss of cytoprotection and increased susceptibility to stressors, while too much NRF2 might disturb homeostatic balance towards a reductive scenario (reductive stress), which would favor protein misfolding and aggregation. Low NRF2 levels in the brain support the idea that a slight up-regulation may be sufficient to achieve a benefit under pathological conditions. In fact, the protective role of pharmacological NRF2-mediated activation of protein clearance has been shown in different neurodegeneration cell culture and in vivo models.

SFN is a pharmacological NRF2 activator that was demonstrated to induce proteasomal and autophagy gene expression [95], [36]. Interestingly, Jo and colleagues demonstrated that SFN reduced the levels of phosphorylated TAU and increased Beclin-1 and LC3-II, suggesting NRF2 activation may facilitate degradation of this toxic protein through autophagy [113]. Moreover, degradation of mHtt was enhanced with SFN, and this was reverted with the use of MG132, indicating proteasomal degradation of this toxic protein [95]. Autophagy-mediated degradation of phospho- and insoluble-TAU was reported with the organic flavonoid fisetin. This compound was able to induce autophagy by simultaneously promoting the activation and nuclear translocation of both TFEB and NRF2, along with some of its target genes. This response was prevented by TFEB or NRF2 silencing [125]. Bott and colleagues reported beneficial effects of a simultaneous NRF2, NRF1 and HSF1 activator on protein toxicity in spinal and bulbar muscular atrophy, a neurodegenerative disorder caused by expansion of polyglutamine-encoding CAG repeats in which protein aggregates are present [126]. The potential of NRF2 activation for the treatment of neurodegenerative disorders has been demonstrated with the approval of BG-12, the oral formulation of the NRF2 inducer dimethyl fumarate (DMF), for the treatment of multiple sclerosis [127], [128]. The success of DMF with autoimmune diseases with a strong inflammatory component suggests that neurodegenerative diseases might benefit from repositioning this drug. In a recent preclinical study of an ?-synucleinopathy model of PD, DMF was shown to be neuroprotective due, in part, to its induction of autophagy [129]. Studies reporting beneficial effects of NRF2 on neurodegeneration but not focusing on its effect on protein clearance are even more abundant (for a comprehensive review, see [7]). This is quite relevant, as it highlights the multiple damaging processes that can be simultaneously targeted by a single hit in NRF2, also including oxidative stress, neuroinflammation or mitochondrial dysfunction. However, future work will be needed to definitely determine if pharmacological activation of NRF2 may be a valid strategy to facilitate degradation of toxic proteins in the brain.

As explained before, exacerbated GSK-3? activity was reported in neurodegenerative diseases and it has been speculated that consequent NRF2 reduction can be partially responsible for the deleterious outcome. Under these pathological conditions, GSK-3 inhibitors could also cooperate to increase NRF2 levels and proteostasis. The beneficial effects of GSK-3 inhibitors have been reported in different models of neurodegeneration and, more interesting, GSK-3 repression was shown to reduce the levels of toxic proteins [130], [131], [132], [133]. Although no direct links between GSK-3 inhibition and NRF2-transcriptional regulation of genes promoting proteostasis have been observed yet, it is reasonable to speculate that down-regulation of GSK-3 activity would result in increased NRF2 levels, which eventually will result in reinforced proteostasis.

The transcriptional activity of NRF2 as well as the cellular capacity to maintain proteostasis decrease with age, the main risk factor for the development of neurodegenerative diseases. It is reasonable to think that the reinforcement of NRF2 and, consequently, proteostasis would, at least, delay the accumulation of protein aggregates and neurodegeneration. Indeed, treatment of human senescent fibroblasts with 18?-glycyrrhetinic acid (18?-GA) triterpenoid promoted NRF2 activation, leading to proteasome induction and enhanced life span. This study suggests that pharmacological activation of NRF2 is possible even in late life [86]. Moreover, a later study showed that this compound mediated SKN-1 and proteasome activation in C.elegans with beneficial effects on AD progression in relevant nematode models [134].

All things considered, NRF2-mediated induction of proteostasis-related genes seems to be beneficial in different proteinopathies.

Sulforaphane and Its Effects on Cancer, Mortality, Aging, Brain and Behavior, Heart Disease & More

Isothiocyanates are some of the most important plant compounds you can get in your diet. In this video I make the most comprehensive case for them that has ever been made. Short attention span? Skip to your favorite topic by clicking one of the time points below. Full timeline below.

Key sections:

  • 00:01:14 – Cancer and mortality
  • 00:19:04 – Aging
  • 00:26:30 – Brain and behavior
  • 00:38:06 – Final recap
  • 00:40:27 – Dose

Full timeline:

  • 00:00:34 – Introduction of sulforaphane, a major focus of the video.
  • 00:01:14 – Cruciferous vegetable consumption and reductions in all-cause mortality.
  • 00:02:12 – Prostate cancer risk.
  • 00:02:23 – Bladder cancer risk.
  • 00:02:34 – Lung cancer in smokers risk.
  • 00:02:48 – Breast cancer risk.
  • 00:03:13 – Hypothetical: what if you already have cancer? (interventional)
  • 00:03:35 – Plausible mechanism driving the cancer and mortality associative data.
  • 00:04:38 – Sulforaphane and cancer.
  • 00:05:32 – Animal evidence showing strong effect of broccoli sprout extract on bladder tumor development in rats.
  • 00:06:06 – Effect of direct supplementation of sulforaphane in prostate cancer patients.
  • 00:07:09 – Bioaccumulation of isothiocyanate metabolites in actual breast tissue.
  • 00:08:32 – Inhibition of breast cancer stem cells.
  • 00:08:53 – History lesson: brassicas were established as having health properties even in ancient Rome.
  • 00:09:16 – Sulforaphane’s ability to enhance carcinogen excretion (benzene, acrolein).
  • 00:09:51 – NRF2 as a genetic switch via antioxidant response elements.
  • 00:10:10 – How NRF2 activation enhances carcinogen excretion via glutathione-S-conjugates.
  • 00:10:34 – Brussels sprouts increase glutathione-S-transferase and reduce DNA damage.
  • 00:11:20 – Broccoli sprout drink increases benzene excretion by 61%.
  • 00:13:31 – Broccoli sprout homogenate increases antioxidant enzymes in the upper airway.
  • 00:15:45 – Cruciferous vegetable consumption and heart disease mortality.
  • 00:16:55 – Broccoli sprout powder improves blood lipids and overall heart disease risk in type 2 diabetics.
  • 00:19:04 – Beginning of aging section.
  • 00:19:21 – Sulforaphane-enriched diet enhances lifespan of beetles from 15 to 30% (in certain conditions).
  • 00:20:34 – Importance of low inflammation for longevity.
  • 00:22:05 – Cruciferous vegetables and broccoli sprout powder seem to reduce a wide variety of inflammatory markers in humans.
  • 00:23:40 – Mid-video recap: cancer, aging sections
  • 00:24:14 – Mouse studies suggest sulforaphane might improve adaptive immune function in old age.
  • 00:25:18 – Sulforaphane improved hair growth in a mouse model of balding. Picture at 00:26:10.
  • 00:26:30 – Beginning of brain and behavior section.
  • 00:27:18 – Effect of broccoli sprout extract on autism.
  • 00:27:48 – Effect of glucoraphanin on schizophrenia.
  • 00:28:17 – Start of depression discussion (plausible mechanism and studies).
  • 00:31:21 – Mouse study using 10 different models of stress-induced depression show sulforaphane similarly effective as fluoxetine (prozac).
  • 00:32:00 – Study shows direct ingestion of glucoraphanin in mice is similarly effective at preventing depression from social defeat stress model.
  • 00:33:01 – Beginning of neurodegeneration section.
  • 00:33:30 – Sulforaphane and Alzheimer’s disease.
  • 00:33:44 – Sulforaphane and Parkinson’s disease.
  • 00:33:51 – Sulforaphane and Hungtington’s disease.
  • 00:34:13 – Sulforaphane increases heat shock proteins.
  • 00:34:43 – Beginning of traumatic brain injury section.
  • 00:35:01 – Sulforaphane injected immediately after TBI improves memory (mouse study).
  • 00:35:55 – Sulforaphane and neuronal plasticity.
  • 00:36:32 – Sulforaphane improves learning in model of type II diabetes in mice.
  • 00:37:19 – Sulforaphane and duchenne muscular dystrophy.
  • 00:37:44 – Myostatin inhibition in muscle satellite cells (in vitro).
  • 00:38:06 – Late-video recap: mortality and cancer, DNA damage, oxidative stress and inflammation, benzene excretion, cardiovascular disease, type II diabetes, effects on the brain (depression, autism, schizophrenia, neurodegeneration), NRF2 pathway.
  • 00:40:27 – Thoughts on figuring out a dose of broccoli sprouts or sulforaphane.
  • 00:41:01 – Anecdotes on sprouting at home.
  • 00:43:14 – On cooking temperatures and sulforaphane activity.
  • 00:43:45 – Gut bacteria conversion of sulforaphane from glucoraphanin.
  • 00:44:24 – Supplements work better when combined with active myrosinase from vegetables.
  • 00:44:56 – Cooking techniques and cruciferous vegetables.
  • 00:46:06 – Isothiocyanates as goitrogens.
Dr Jimenez White Coat
The nuclear factor erythroid-derived 2 (NF-E2)-related factor 2, otherwise known as Nrf2, is a transcription factor which regulates the expression of a variety of antioxidant and detoxifying enzymes. Research studies have also demonstrated its role in controlling oxidative stress. Most neurodegenerative diseases, such as Alzheimer’s disease and Parkinson’s disease, are characterized by oxidative stress and chronic inflammation, the common targets of Nrf2 treatment approaches. Dr. Alex Jimenez D.C., C.C.S.T. Insight

Concluding Remarks

Transcription factor NRF2 orchestrates a proteostatic response by sensing to and modulating changes in the UPR, UPS and autophagy (Fig. 4). Consequently, the lack of NRF2 has been shown to aggravate proteinopathy, suggesting that NRF2 is necessary for optimal protein clearance. All together, we can speculate that NRF2 might be an interesting therapeutic target for proteinopathies.

Figure 4 NRF2 as a hub connecting proteotoxic-derived emergency signals to a protective transcriptional response. The accumulation of unfolded/misfolded proteins will lead to the activation of the unfolded protein response (UPR) in the ER. Activation of PERK or MAPK may result in the transcriptional induction of the ER-resident Gpx8 and several enzymes regulating GSH levels, critical to ensure correct protein folding. Protein aggregates inhibit proteasome activity (UPS), probably avoiding NRF2 degradation. NRF2 has been shown to specifically modulate the transcription of Psma3, Psma6, Psmb1, Psmb5 and Pomp genes. Several other subunits were up-regulated in an NRF2-dependent manner in response to D3T, probably enlarging the list of proteasome subunits regulated by NRF2. Autophagy is the main pathway for the degradation of protein aggregates. Autophagy also regulates NRF2, connecting this degradation pathway with NRF2 transcriptional induction of p62, Ndp52, Ulk1, Atg2b, Atg4c, Atg5, Atg7 and Gabarapl1.

Acknowledgements

Sciencedirect.com/science/article/pii/S2213231716304050

According to the article above, while the symptoms of neurodegenerative diseases can be treated through a variety of treatment options, research studies have demonstrated that Nrf2 activation can be a helpful treatment approach. Because Nrf2 activators target broad mechanisms of disease, all neurodegenerative diseases can benefit from the use of the Nrf2 transcription factor. The findings of Nrf2 have revolutionized the treatment of neurodegenerative diseases. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.

Curated by Dr. Alex Jimenez

Referenced from:�Sciencedirect.com

Green Call Now Button H .png

Additional Topic Discussion: Relieving Knee Pain without Surgery

Knee pain is a well-known symptom which can occur due to a variety of knee injuries and/or conditions, including�sports injuries. The knee is one of the most complex joints in the human body as it is made-up of the intersection of four bones, four ligaments, various tendons, two menisci, and cartilage. According to the American Academy of Family Physicians, the most common causes of knee pain include patellar subluxation, patellar tendinitis or jumper’s knee, and Osgood-Schlatter disease. Although knee pain is most likely to occur in people over 60 years old, knee pain can also occur in children and adolescents. Knee pain can be treated at home following the RICE methods, however, severe knee injuries may require immediate medical attention, including chiropractic care. �

blog picture of cartoon paper boy

EXTRA EXTRA | IMPORTANT TOPIC: Recommended El Paso, TX Chiropractor

***

Nrf2 Explained: The Keap1-Nrf2 Pathway

Nrf2 Explained: The Keap1-Nrf2 Pathway

Oxidative stress is described as cell damage caused by free radicals, or unstable molecules, which can ultimately affect healthy function. The human body creates free radicals to neutralize bacteria and viruses, however, external factors, such as oxygen, pollution, and radiation, can often also produce free radicals. Oxidative stress has been associated with numerous health issues.

 

Oxidative stress and other stressors turn on internal protective mechanisms which can help regulate the human body’s antioxidant response. Nrf2 is a protein which senses levels of oxidative stress and enables the cells to protect themselves from internal and external factors. Nrf2 has also been demonstrated to help regulate genes involved in the production of antioxidant enzymes and stress-response genes. The purpose of the article below is to explain the effects of Nrf2 in cancer.

 

Abstract

 

The Keap1-Nrf2 pathway is the major regulator of cytoprotective responses to oxidative and electrophilic stress. Although cell signaling pathways triggered by the transcription factor Nrf2 prevent cancer initiation and progression in normal and premalignant tissues, in fully malignant cells Nrf2 activity provides growth advantage by increasing cancer chemoresistance and enhancing tumor cell growth. In this graphical review, we provide an overview of the Keap1-Nrf2 pathway and its dysregulation in cancer cells. We also briefly summarize the consequences of constitutive Nrf2 activation in cancer cells and how this can be exploited in cancer gene therapy.

 

Keywords: Nrf2, Keap1, Cancer, Antioxidant response element, Gene therapy

 

Introduction

 

The Keap1-Nrf2 pathway is the major regulator of cytoprotective responses to endogenous and exogenous stresses caused by reactive oxygen species (ROS) and electrophiles [1]. The key signaling proteins within the pathway are the transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) that binds together with small Maf proteins to the antioxidant response element (ARE) in the regulatory regions of target genes, and Keap1 (Kelch ECH associating protein 1), a repressor protein that binds to Nrf2 and promotes its degradation by the ubiquitin proteasome pathway (Fig. 1). Keap1 is a very cysteine-rich protein, mouse Keap1 having a total of 25 and human 27 cysteine residues, most of which can be modified in vitro by different oxidants and electrophiles [2]. Three of these residues, C151, C273 and C288, have been shown to play a functional role by altering the conformation of Keap1 leading to nuclear translocation of Nrf2 and subsequent target gene expression [3] (Fig. 1). The exact mechanism whereby cysteine modifications in Keap1 lead to Nrf2 activation is not known, but the two prevailing but not mutually exclusive models are (1) the �hinge and latch� model, in which Keap1 modifications in thiol residues residing in the IVR of Keap1 disrupt the interaction with Nrf2 causing a misalignment of the lysine residues within Nrf2 that can no longer be polyubiquitinylated and (2) the model in which thiol modification causes dissociation of Cul3 from Keap1 [3]. In both models, the inducer-modified and Nrf2-bound Keap1 is inactivated and, consequently, newly synthesized Nrf2 proteins bypass Keap1 and translocate into the nucleus, bind to the ARE and drive the expression of Nrf2 target genes such as NAD(P)H quinone oxidoreductase 1 (NQO1), heme oxygenase 1 (HMOX1), glutamate-cysteine ligase (GCL) and glutathione S transferases (GSTs) (Fig. 2). In addition to modifications of Keap1 thiols resulting in Nrf2 target gene induction, proteins such as p21 and p62 can bind to Nrf2 or Keap1 thereby disrupting the interaction between Nrf2 and Keap1 [1], [3] (Fig. 3).

 

Fig. 1. Structures of Nrf2 and Keap1 and the cysteine code. (A) Nrf2 consists of 589 amino acids and has six evolutionarily highly conserved domains, Neh1-6. Neh1 contains a bZip motif, a basic region � leucine zipper (L-Zip) structure, where the basic region is responsible for DNA recognition and the L-Zip mediates dimerization with small Maf proteins. Neh6 functions as a degron to mediate degradation of Nrf2 in the nucleus. Neh4 and 5 are transactivation domains. Neh2 contains ETGE and DLG motifs, which are required for the interaction with Keap1, and a hydrophilic region of lysine residues (7 K), which are indispensable for the Keap1-dependent polyubiquitination and degradation of Nrf2. (B) Keap1 consists of 624 amino acid residues and has five domains. The two protein�protein interaction motifs, the BTB domain and the Kelch domain, are separated by the intervening region (IVR). The BTB domain together with the N-terminal portion of the IVR mediates homodimerization of Keap1 and binding with Cullin3 (Cul3). The Kelch domain and the C-terminal region mediate the interaction with Neh2. (C) Nrf2 interacts with two molecules of Keap1 through its Neh2 ETGE and DLG motifs. Both ETGE and DLG bind to similar sites on the bottom surface of the Keap1 Kelch motif. (D) Keap1 is rich in cysteine residues, with 27 cysteines in human protein. Some of these cysteines are located near basic residues and are therefore excellent targets of electrophiles and oxidants. The modification pattern of the cysteine residues by electrophiles is known as the cysteine code. The cysteine code hypothesis proposes that structurally different Nrf2 activating agents affect different Keap1 cysteines. The cysteine modifications lead to conformational changes in the Keap1 disrupting the interaction between the Nrf2 DLG and Keap1 Kelch domains, thus inhibiting the polyubiquitination of Nrf2. The functional importance of Cys151, Cys273 and Cys288 has been shown, as Cys273 and Cys288 are required for suppression of Nrf2 and Cys151 for activation of Nrf2 by inducers [1], [3].

 

Fig. 2. The Nrf2-Keap1 signaling pathway. (A and B) in basal conditions, two Keap1 molecules bind to Nrf2 and Nrf2 is polyubiquitylated by the Cul3-based E3 ligase complex. This polyubiquitilation results in rapid Nrf2 degradation by the proteasome. A small proportion of Nrf2 escapes the inhibitory complex and accumulates in the nucleus to mediate basal ARE-dependent gene expression, thereby maintaining the cellular homeostasis. (C) Under stress conditions, inducers modify the Keap1 cysteines leading to the inhibition of Nrf2 ubiquitylation via dissociation of the inhibitory complex. (D) According to the hinge and latch model, modification of specific Keap1 cysteine residues leads to conformational changes in Keap1 resulting in the detachment of the Nrf2 DLG motif from Keap1. Ubiquitination of Nrf2 is disrupted but the binding with the ETGE motif remains. (E) In the Keap1-Cul3 dissociation model, the binding of Keap1 and Cul3 is disrupted in response to electrophiles, leading to the escape of Nrf2 from the ubiquitination system. In both of the suggested models, the inducer-modified and Nrf2-bound Keap1 is inactivated and, consequently, newly synthesized Nrf2 proteins bypass Keap1 and translocate into the nucleus, bind to the Antioxidant Response Element (ARE) and drive the expression of Nrf2 target genes such as NQO1, HMOX1, GCL and GSTs [1], [3].

 

Fig. 3. Mechanisms for constitutive nuclear accumulation of Nrf2 in cancer. (A) Somatic mutations in Nrf2 or Keap1 disrupt the interaction of these two proteins. In Nrf2, mutations affect ETGE and DLG motifs, but in Keap1 mutations are more evenly distributed. Furthermore, oncogene activation, such as KrasG12D[5], or disruption of tumor suppressors, such as PTEN [11] can lead to transcriptional induction of Nrf2 and an increase in nuclear Nrf2. (B) Hypermethylation of the Keap1 promoter in lung and prostate cancer leads to reduction of Keap1 mRNA expression, which increases the nuclear accumulation of Nrf2 [6], [7]. (C) In familial papillary renal carcinoma, the loss of fumarate hydratase enzyme activity leads to the accumulation of fumarate and further to succination of Keap1 cysteine residues (2SC). This post-translational modification leads to the disruption of Keap1-Nrf2 interaction and nuclear accumulation of Nrf2 [8], [9]. (D) Accumulation of disruptor proteins such as p62 and p21 can disturb Nrf2-Keap1 binding and results in an increase in nuclear Nrf2. p62 binds to Keap1 overlapping the binding pocket for Nrf2 and p21 directly interacts with the DLG and ETGE motifs of Nrf2, thereby competing with Keap1 [10].

 

Mechanisms of Activation and Dysregulation of Nrf2 in Cancer

 

Although cytoprotection provided by Nrf2 activation is important for cancer chemoprevention in normal and premalignant tissues, in fully malignant cells Nrf2 activity provides growth advantage by increasing cancer chemoresistance and enhancing tumor cell growth [4]. Several mechanisms by which Nrf2 signaling pathway is constitutively activated in various cancers have been described: (1) somatic mutations in Keap1 or the Keap1 binding domain of Nrf2 disrupting their interaction; (2) epigenetic silencing of Keap1 expression leading to defective repression of Nrf2; (3) accumulation of disruptor proteins such as p62 leading to dissociation of the Keap1-Nrf2 complex; (4) transcriptional induction of Nrf2 by oncogenic K-Ras, B-Raf and c-Myc; and (5) post-translational modification of Keap1 cysteines by succinylation that occurs in familial papillary renal carcinoma due to the loss of fumarate hydratase enzyme activity [3], [4], [5], [6], [7], [8], [9], [10] (Fig. 3). Constitutively abundant Nrf2 protein causes increased expression of genes involved in drug metabolism thereby increasing the resistance to chemotherapeutic drugs and radiotherapy. In addition, high Nrf2 protein level is associated with poor prognosis in cancer [4]. Overactive Nrf2 also affects cell proliferation by directing glucose and glutamine towards anabolic pathways augmenting purine synthesis and influencing the pentose phosphate pathway to promote cell proliferation [11] (Fig. 4).

 

Fig. 4. The dual role of Nrf2 in tumorigenesis. Under physiological conditions, low levels of nuclear Nrf2 are sufficient for the maintenance of cellular homeostasis. Nrf2 inhibits tumor initiation and cancer metastasis by eliminating carcinogens, ROS and other DNA-damaging agents. During tumorigenesis, accumulating DNA damage leads to constitutive hyperactivity of Nrf2 which helps the autonomous malignant cells to endure high levels of endogenous ROS and to avoid apoptosis. Persistently elevated nuclear Nrf2 levels activate metabolic genes in addition to the cytoprotective genes contributing to metabolic reprogramming and enhanced cell proliferation. Cancers with high Nrf2 levels are associated with poor prognosis because of radio and chemoresistance and aggressive cancer cell proliferation. Thus, Nrf2 pathway activity is protective in the early stages of tumorigenesis, but detrimental in the later stages. Therefore, for the prevention of cancer, enhancing Nrf2 activity remains an important approach whereas for the treatment of cancer, Nrf2 inhibition is desirable [4], [11].

 

Given that high Nrf2 activity commonly occurs in cancer cells with adverse outcomes, there is a need for therapies to inhibit Nrf2. Unfortunately, due to structural similarity with some other bZip family members, the development of specific Nrf2 inhibitors is a challenging task and only a few studies of Nrf2 inhibition have been published to date. By screening natural products, Ren et al. [12] identified an antineoplastic compound brusatol as an Nrf2 inhibitor that enhances the chemotherapeutic efficacy of cisplatin. In addition, PI3K inhibitors [11], [13] and Nrf2 siRNA [14] have been used to inhibit Nrf2 in cancer cells. Recently, we have utilized an alternative approach, known as cancer suicide gene therapy, to target cancer cells with high Nrf2 levels. Nrf2-driven lentiviral vectors [15] containing thymidine kinase (TK) are transferred into cancer cells with high ARE activity and the cells are treated with a pro-drug, ganciclovir (GCV). GCV is metabolized to GCV-monophosphate, which is further phosphorylated by cellular kinases into a toxic triphosphate form [16] (Fig. 5). This leads to effective killing of not only TK containing tumor cells, but also the neighboring cells due to the bystander effect [17]. ARE-regulated TK/GCV gene therapy can be further enhanced via combining a cancer chemotherapeutic agent doxorubicin to the treatment [16], supporting the notion that this approach could be useful in conjuction with traditional therapies.

 

Fig. 5. Suicide gene therapy. Constitutive Nrf2 nuclear accumulation in cancer cells can be exploited by using Nrf2-driven viral vector for cancer suicide gene therapy [16]. In this approach, lentiviral vector (LV) expressing thymidine kinase (TK) under minimal SV40 promoter with four AREs is transduced to lung adenocarcinoma cells. High nuclear Nrf2 levels lead to robust expression of TK through Nrf2 binding. Cells are then treated with a pro-drug, ganciclovir (GCV), which is phosphorylated by TK. Triphosphorylated GCV disrupts DNA synthesis and leads to effective killing of not only TK containing tumor cells, but also the neighboring cells due to the bystander effect.

 

Dr Jimenez White Coat

Nrf2 is a master regulator which triggers the production of powerful antioxidants in the human body which help eliminate oxidative stress. Various antioxidant enzymes, such as superoxide dismutase, or SOD, glutathione, and catalase, are also activated through the Nrf2 pathway. Furthermore, certain phytochemicals like turmeric, ashwagandha, bacopa, green tea, and milk thistle, activate Nrf2. Research studies have found that Nrf2 activation can naturally enhance cellular protection and restore balance to the human body.

Dr. Alex Jimenez D.C., C.C.S.T. Insight

 

Sulforaphane and Its Effects on Cancer, Mortality, Aging, Brain and Behavior, Heart Disease & More

 

Isothiocyanates are some of the most important plant compounds you can get in your diet. In this video I make the most comprehensive case for them that has ever been made. Short attention span? Skip to your favorite topic by clicking one of the time points below. Full timeline below.

 

Key sections:

 

  • 00:01:14 – Cancer and mortality
  • 00:19:04 – Aging
  • 00:26:30 – Brain and behavior
  • 00:38:06 – Final recap
  • 00:40:27 – Dose

 

Full timeline:

 

  • 00:00:34 – Introduction of sulforaphane, a major focus of the video.
  • 00:01:14 – Cruciferous vegetable consumption and reductions in all-cause mortality.
  • 00:02:12 – Prostate cancer risk.
  • 00:02:23 – Bladder cancer risk.
  • 00:02:34 – Lung cancer in smokers risk.
  • 00:02:48 – Breast cancer risk.
  • 00:03:13 – Hypothetical: what if you already have cancer? (interventional)
  • 00:03:35 – Plausible mechanism driving the cancer and mortality associative data.
  • 00:04:38 – Sulforaphane and cancer.
  • 00:05:32 – Animal evidence showing strong effect of broccoli sprout extract on bladder tumor development in rats.
  • 00:06:06 – Effect of direct supplementation of sulforaphane in prostate cancer patients.
  • 00:07:09 – Bioaccumulation of isothiocyanate metabolites in actual breast tissue.
  • 00:08:32 – Inhibition of breast cancer stem cells.
  • 00:08:53 – History lesson: brassicas were established as having health properties even in ancient Rome.
  • 00:09:16 – Sulforaphane’s ability to enhance carcinogen excretion (benzene, acrolein).
  • 00:09:51 – NRF2 as a genetic switch via antioxidant response elements.
  • 00:10:10 – How NRF2 activation enhances carcinogen excretion via glutathione-S-conjugates.
  • 00:10:34 – Brussels sprouts increase glutathione-S-transferase and reduce DNA damage.
  • 00:11:20 – Broccoli sprout drink increases benzene excretion by 61%.
  • 00:13:31 – Broccoli sprout homogenate increases antioxidant enzymes in the upper airway.
  • 00:15:45 – Cruciferous vegetable consumption and heart disease mortality.
  • 00:16:55 – Broccoli sprout powder improves blood lipids and overall heart disease risk in type 2 diabetics.
  • 00:19:04 – Beginning of aging section.
  • 00:19:21 – Sulforaphane-enriched diet enhances lifespan of beetles from 15 to 30% (in certain conditions).
  • 00:20:34 – Importance of low inflammation for longevity.
  • 00:22:05 – Cruciferous vegetables and broccoli sprout powder seem to reduce a wide variety of inflammatory markers in humans.
  • 00:23:40 – Mid-video recap: cancer, aging sections
  • 00:24:14 – Mouse studies suggest sulforaphane might improve adaptive immune function in old age.
  • 00:25:18 – Sulforaphane improved hair growth in a mouse model of balding. Picture at 00:26:10.
  • 00:26:30 – Beginning of brain and behavior section.
  • 00:27:18 – Effect of broccoli sprout extract on autism.
  • 00:27:48 – Effect of glucoraphanin on schizophrenia.
  • 00:28:17 – Start of depression discussion (plausible mechanism and studies).
  • 00:31:21 – Mouse study using 10 different models of stress-induced depression show sulforaphane similarly effective as fluoxetine (prozac).
  • 00:32:00 – Study shows direct ingestion of glucoraphanin in mice is similarly effective at preventing depression from social defeat stress model.
  • 00:33:01 – Beginning of neurodegeneration section.
  • 00:33:30 – Sulforaphane and Alzheimer’s disease.
  • 00:33:44 – Sulforaphane and Parkinson’s disease.
  • 00:33:51 – Sulforaphane and Hungtington’s disease.
  • 00:34:13 – Sulforaphane increases heat shock proteins.
  • 00:34:43 – Beginning of traumatic brain injury section.
  • 00:35:01 – Sulforaphane injected immediately after TBI improves memory (mouse study).
  • 00:35:55 – Sulforaphane and neuronal plasticity.
  • 00:36:32 – Sulforaphane improves learning in model of type II diabetes in mice.
  • 00:37:19 – Sulforaphane and duchenne muscular dystrophy.
  • 00:37:44 – Myostatin inhibition in muscle satellite cells (in vitro).
  • 00:38:06 – Late-video recap: mortality and cancer, DNA damage, oxidative stress and inflammation, benzene excretion, cardiovascular disease, type II diabetes, effects on the brain (depression, autism, schizophrenia, neurodegeneration), NRF2 pathway.
  • 00:40:27 – Thoughts on figuring out a dose of broccoli sprouts or sulforaphane.
  • 00:41:01 – Anecdotes on sprouting at home.
  • 00:43:14 – On cooking temperatures and sulforaphane activity.
  • 00:43:45 – Gut bacteria conversion of sulforaphane from glucoraphanin.
  • 00:44:24 – Supplements work better when combined with active myrosinase from vegetables.
  • 00:44:56 – Cooking techniques and cruciferous vegetables.
  • 00:46:06 – Isothiocyanates as goitrogens.

 

Acknowledgments

 

This work was supported by the Academy of Finland, the Sigrid Juselius Foundation and the Finnish Cancer Organisations.

 

In conclusion, nuclear factor (erythroid-derived 2)-like 2, also known as NFE2L2 or Nrf2, is a protein which increases the production of antioxidants which protect the human body against oxidative stress. As described above, the stimulation of the Nrf2 pathway are being studies for the treatment of diseases caused by oxidative stress, including cancer. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.

 

Curated by Dr. Alex Jimenez

 

Referenced from:�Sciencedirect.com

 

Green Call Now Button H .png

 

Additional Topic Discussion: Relieving Knee Pain without Surgery

 

Knee pain is a well-known symptom which can occur due to a variety of knee injuries and/or conditions, including�sports injuries. The knee is one of the most complex joints in the human body as it is made-up of the intersection of four bones, four ligaments, various tendons, two menisci, and cartilage. According to the American Academy of Family Physicians, the most common causes of knee pain include patellar subluxation, patellar tendinitis or jumper’s knee, and Osgood-Schlatter disease. Although knee pain is most likely to occur in people over 60 years old, knee pain can also occur in children and adolescents. Knee pain can be treated at home following the RICE methods, however, severe knee injuries may require immediate medical attention, including chiropractic care.

 

 

blog picture of cartoon paper boy

 

EXTRA EXTRA | IMPORTANT TOPIC: Recommended El Paso, TX Chiropractor

 

***

What is Nrf2 Activation?

What is Nrf2 Activation?

DNA supports approximately 20,000 genes, each holding a program for the creation of a protein or enzyme required for a healthy lifestyle. Every one of these patterns needs to be constantly regulated by a sort of “promoter” which manages exactly how much of each substance and/or chemical is generated and under which conditions these will also develop.

 

By connecting to a particular kind of the switch-like promoter areas, known as the Antioxidant Response Element, or ARE, the Nrf2 factor�supports the speed of creation for hundreds of distinct genes which enable the cells to survive under stressful circumstances. These genes then generate a selection of antioxidant enzymes which develop a defense network by neutralizing oxidants and by cleaning up the toxic by-products left behind in their�production, in addition to helping restore the�damage they caused.

 

 

What is Oxidative Stress?

 

Several oxidants like the superoxide radical, or O2-., and hydrogen peroxide, or H2O2, have been created through the practice of burning off the substances and/or chemicals which sustain the human body. The human body�possesses antioxidant enzymes which�neutralize and detoxify reactive foods and drinks we consume. The Nrf2 modulates their production to keep equilibrium and underscores the demand for all these enzymes. This balance can be interrupted by a�couple of factors, including age.

 

As we age,�the human body creates less Nrf2 and this delicate equilibrium can gradually begin to�turn towards the oxidative side, a state referred to as oxidative stress. Disease may also cause the overproduction of oxidants. Infections, allergies, and autoimmune disorders can additionally trigger our immune cells to create reactive oxidants, such as O2-. , H2O2, OH and HOCl, where healthy cells become damaged and respond with inflammation. Diseases associated with aging, including heart attacks, stroke, cancer, and neurodegenerative conditions like Alzheimer’s disease, also increase the development of oxidants, generating stress and an inflammation response.

 

What are Nrf2 Activators?

 

The Nrf2 protein, also called a transcription factor due to the way it can support and control enzymes and genes, is the secret element of a sequence of biochemical reactions within the cell which reacts to modifications in cognitive equilibrium as well as oxidative balance. The sensing elements of this pathway modify and discharge Nrf2, triggering it so it might spread into the nucleus of the cell towards the DNA. The Nrf2 may alternatively turn on or switch off the genes and enzymes it supports to protect the cell.

 

Fortunately, a variety of substances which are Nrf2 activators develop through the consumption of certain plants and extracts utilized centuries ago in Chinese and Native American traditional remedies. These phytochemicals seem to be equally as powerful with fewer side-effects, as the Nrf2-activating pharmaceutical products which are being used today.

 

Dr Jimenez White Coat

Nuclear factor erythroid 2-related factor, more commonly known as Nrf2, is a transcription factor which protects the cell by regulating genes, enzymes and antioxidant responses. Transcription factors are a type of protein which attach to DNA to promote the creation of specific substances and chemicals, including glutathione S-transferases, or GSTs. Nrf2 activation induces the production of active proteins which exhibit a powerful antioxidant capacity to help decrease oxidative stress.

Dr. Alex Jimenez D.C., C.C.S.T. Insight

 

The Science Behind Nrf2 Activation

 

Once the initial Nrf2-activating dietary supplement was created in 2004, minimal information was known concerning the function of the Nrf2 pathway. Approximately 200 newspapers in the literature on Nrf2, also known as nuclear factor-like 2 or NFE2L2, existed and researchers were only just starting to discover the antioxidant response of Nrf2 in mammals. As of 2017, however, over 9,300 academic research studies on this “master regulator,” have been printed.

 

In reality, Nrf2 regulates many antioxidant enzymes which don’t correlate to the genes, instead, they offer protection against a variety of stress-related circumstances which are encountered by cells, organs and ultimately organisms, under healthy and pathological conditions. Based on this new quantity of information from published academic research studies, researchers can now develop better Nrf2 dietary supplements.

 

As of 2007,�research studies have demonstrated the complex function of the Nrf2 pathway. Nrf2 activators have been found to mimic factors of different structures within the human body. Through these pathways, Nrf2 activators have been equipped to feel changing conditions throughout the cell in order to keep balance and respond to the evolving requirements of the genes.

 

 

Why Use Nrf2-Activating Supplements?

 

As Nrf2-activation abilities diminish with age in organisms, changes may begin to occur. Research studies have demonstrated that the focus of Nrf2 in cells declines with age, showing increased markers of oxidative stress. A variety of age-related diseases like atherosclerosis and cardiovascular disease, arthritis, cancer, obesity, type 2 diabetes, hypertension, cataracts, and Alzheimer’s disease as well as Parkinson’s diseases can develop due to these changes. Oxidative stress has been found with these health issues.

 

By stimulating the cell’s capacity to increase the production of Nrf2 activators, Nrf2 dietary supplements can help revive the human body’s own ability to counteract the effects of oxidative stress. Polyunsaturated fatty acids, or PUFAs, are one of the most readily oxidized molecules and they’re particularly vulnerable to suffer damage from free radicals. Thiobarbituric acid, or TBARS, production can increase with age, indicating heightened oxidative stress along with a drop in Nrf2-regulated pathways.

 

Biologically, gene induction is a really slow mechanism, generally requiring hours to transfer through a pathway. As a result,�many enzymes possess their very own on/off switches which could be triggered in minutes by different regulatory enzymes. Researchers have developed proprietary compositions of Nrf2 activators which utilize this knowledge base of activation. Nrf2 activation is composed not just of the Nrf2 transcription factor being discharged from its inhibitor and migrating to the cell nucleus, but also binding to specific DNA sequences to encourage cytoprotective gene expression, regulating the pace at that Nrf2 is taken out of the nucleus.

 

Understanding the elimination procedure and the activation of Nrf2 in the human body has allowed researchers to build combinations of different Nrf2 activators to accomplish the reflection of genes through its modulation. The combination of the knowledge base, together with the wide variety of other research studies has�helped produce Nrf2 activators for use as dietary supplements. The scope of our information is limited to chiropractic and spinal health issues. To discuss the subject matter, please feel free to ask Dr. Jimenez or contact us at�915-850-0900�.

 

Curated by Dr. Alex Jimenez

 

Green Call Now Button H .png

 

Additional Topic Discussion: Relieving Knee Pain without Surgery

 

Knee pain is a well-known symptom which can occur due to a variety of knee injuries and/or conditions, including�sports injuries. The knee is one of the most complex joints in the human body as it is made-up of the intersection of four bones, four ligaments, various tendons, two menisci, and cartilage. According to the American Academy of Family Physicians, the most common causes of knee pain include patellar subluxation, patellar tendinitis or jumper’s knee, and Osgood-Schlatter disease. Although knee pain is most likely to occur in people over 60 years old, knee pain can also occur in children and adolescents. Knee pain can be treated at home following the RICE methods, however, severe knee injuries may require immediate medical attention, including chiropractic care.

 

 

blog picture of cartoon paper boy

 

EXTRA EXTRA | IMPORTANT TOPIC: Recommended El Paso, TX Chiropractor

 

 

***

 

How Chiropractic Can Be Used As Supportive Care For Cancer

How Chiropractic Can Be Used As Supportive Care For Cancer

Cancer puts a tremendous amount of stress on the body. Cancer treatments add to that stress, affecting the organs as well as the musculoskeletal system. Pain is a common complaint among cancer patients. They experience a variety of aches and pains including headaches, neck pain, muscle tension, and back pain as well as painful peripheral neuropathy. They may also have mobility problems and difficulty walking.

Many cancer patients have found chiropractic care to be a very effective treatment for pain management and to improve flexibility, mobility, and muscle strength. They find it helps to reduce stress and helps the body function more efficiently.

It provides these benefits without the use of medication or invasive treatments. For patients undergoing chemotherapy, it is very beneficial because chiropractic�s whole body approach to wellness helps to combat the debilitating effects of the treatment.

Benefits of Chiropractic Care for Cancer Patients

There are many different reasons that cancer patients may seek chiropractic treatment. Cancer is, in itself, very hard on the body. The disease can cause headaches, muscle stiffness, neck pain, and back pain. However, the treatments can also cause problems.

Patients undergoing radiation treatment must lie on a table for extended periods of time which can be very uncomfortable. Surgery can cause pain in the joints and connective tissues. Chemotherapy drugs can cause unpleasant side effects including nausea, neuropathy, and headaches.

Some of the ways chiropractic care can help cancer patients include:

  • The relief of nausea, headaches, and fatigue
  • Improved balance
  • Alleviation of neck and back pain and stiffness
  • Reduction of joint inflammation
  • Better mobility
  • Restoration of nerve function
  • Reduced muscle tension

Often cancer patients have also reported improvements beyond the typical musculoskeletal complaints that chiropractic treats. Reduced effects of peripheral neuropathy, improved digestion, and even easier respiratory function are just some of the added benefits.

cancer chiropractic support el paso tx.

Chiropractic Treatment Approaches

Chiropractors use a drug-free, hands-on approach to treatment for a wide range of issues. It restores nerve function, corrects musculoskeletal problems, and helps to bring the body back into proper alignment. It is non-invasive and offers patients a safe, natural alternative to medications and other treatments that can have unwanted side effects.

One barrier that may prevent a patient from seeking chiropractic care is the common misconception that it is aggressive and forceful, even painful. The truth is, most chiropractic techniques are very gentle, applying very low force and some no force at all.

Most are also not painful at all and work quickly to enhance the range of motion and increase energy as well as reduce pain. It can help relieve a patient�s symptoms while helping them stay strong while they undergo treatment.

Some of the chiropractic treatment options that are used for cancer patients include:

  • Spinal manipulation
  • Ice
  • Heat
  • Hands-on adjustments
  • Non-force techniques
  • Electrical muscle stimulation
  • Massage
  • Special instrument applications
  • Traction

The Whole-Body Wellness Advantage

Whole body wellness is an integral part of chiropractic care. It can involve diet modification, lifestyle changes, exercise, and stress reduction practices.

When a chiropractor treats a cancer patient � or any patient � he or she will look beyond the obvious issues or symptoms to find the root of the problem and ways to help the body heal itself. Sometimes this may involve supplements, vitamins, or minerals that will aid in correcting the condition. Other times it may simply be a matter of getting the body to a healthy state where it is strong enough to combat the condition or heal from injury.

The treatment is individualized and tailored specifically to the patient�s needs and lifestyle. For instance, many conditions benefit from weight loss or exercise, and many pain issues respond well to adjustments in diet and stress reduction. Chiropractic looks at the whole body and works to provide it with what it needs to get strong and get healthy.

Chiropractor Recommended

Mastodon